ID: 926449210

View in Genome Browser
Species Human (GRCh38)
Location 2:12981872-12981894
Sequence ATGTGAGGATATTAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926449210_926449216 9 Left 926449210 2:12981872-12981894 CCCACTTCCTAATATCCTCACAT No data
Right 926449216 2:12981904-12981926 GGTTTCAACATATGAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926449210 Original CRISPR ATGTGAGGATATTAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr