ID: 926451073

View in Genome Browser
Species Human (GRCh38)
Location 2:13004787-13004809
Sequence CTAGCACAGAACTTATTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926451070_926451073 7 Left 926451070 2:13004757-13004779 CCAACAAACATTTATTTTGCCAT No data
Right 926451073 2:13004787-13004809 CTAGCACAGAACTTATTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926451073 Original CRISPR CTAGCACAGAACTTATTTCT GGG Intergenic
No off target data available for this crispr