ID: 926458968

View in Genome Browser
Species Human (GRCh38)
Location 2:13103729-13103751
Sequence CCCAACAACCAAACTGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926458954_926458968 6 Left 926458954 2:13103700-13103722 CCCACCCCATCCCTCCCTATCCA No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458956_926458968 2 Left 926458956 2:13103704-13103726 CCCCATCCCTCCCTATCCATCCC No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458955_926458968 5 Left 926458955 2:13103701-13103723 CCACCCCATCCCTCCCTATCCAT No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458950_926458968 16 Left 926458950 2:13103690-13103712 CCTGCCCTTCCCCACCCCATCCC No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458951_926458968 12 Left 926458951 2:13103694-13103716 CCCTTCCCCACCCCATCCCTCCC No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458961_926458968 -8 Left 926458961 2:13103714-13103736 CCCTATCCATCCCTCCCCAACAA No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458959_926458968 -4 Left 926458959 2:13103710-13103732 CCCTCCCTATCCATCCCTCCCCA No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458952_926458968 11 Left 926458952 2:13103695-13103717 CCTTCCCCACCCCATCCCTCCCT No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458953_926458968 7 Left 926458953 2:13103699-13103721 CCCCACCCCATCCCTCCCTATCC No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458960_926458968 -5 Left 926458960 2:13103711-13103733 CCTCCCTATCCATCCCTCCCCAA No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458957_926458968 1 Left 926458957 2:13103705-13103727 CCCATCCCTCCCTATCCATCCCT No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458948_926458968 20 Left 926458948 2:13103686-13103708 CCTCCCTGCCCTTCCCCACCCCA No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458962_926458968 -9 Left 926458962 2:13103715-13103737 CCTATCCATCCCTCCCCAACAAC No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458958_926458968 0 Left 926458958 2:13103706-13103728 CCATCCCTCCCTATCCATCCCTC No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data
926458949_926458968 17 Left 926458949 2:13103689-13103711 CCCTGCCCTTCCCCACCCCATCC No data
Right 926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926458968 Original CRISPR CCCAACAACCAAACTGCTTC CGG Intergenic
No off target data available for this crispr