ID: 926460055

View in Genome Browser
Species Human (GRCh38)
Location 2:13117957-13117979
Sequence CTGTAGTTAGAGATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926460055_926460062 29 Left 926460055 2:13117957-13117979 CCAGGCTCCATCTCTAACTACAG No data
Right 926460062 2:13118009-13118031 ACATTCTGTCTCTTCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926460055 Original CRISPR CTGTAGTTAGAGATGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr