ID: 926474110

View in Genome Browser
Species Human (GRCh38)
Location 2:13301039-13301061
Sequence TGATGGAATTATAGTGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926474106_926474110 23 Left 926474106 2:13300993-13301015 CCAAGACAAGGACCTATCAATCA No data
Right 926474110 2:13301039-13301061 TGATGGAATTATAGTGATTATGG No data
926474107_926474110 11 Left 926474107 2:13301005-13301027 CCTATCAATCAGATTTTGTCACA No data
Right 926474110 2:13301039-13301061 TGATGGAATTATAGTGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926474110 Original CRISPR TGATGGAATTATAGTGATTA TGG Intergenic
No off target data available for this crispr