ID: 926476288

View in Genome Browser
Species Human (GRCh38)
Location 2:13326929-13326951
Sequence CTGTAGTACAAGTAGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926476288_926476289 -2 Left 926476288 2:13326929-13326951 CCTCAGGGCTACTTGTACTACAG No data
Right 926476289 2:13326950-13326972 AGCTTAGATATACTGCAAAATGG No data
926476288_926476290 12 Left 926476288 2:13326929-13326951 CCTCAGGGCTACTTGTACTACAG No data
Right 926476290 2:13326964-13326986 GCAAAATGGTTTTCCTCCTTTGG No data
926476288_926476291 13 Left 926476288 2:13326929-13326951 CCTCAGGGCTACTTGTACTACAG No data
Right 926476291 2:13326965-13326987 CAAAATGGTTTTCCTCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926476288 Original CRISPR CTGTAGTACAAGTAGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr