ID: 926478494

View in Genome Browser
Species Human (GRCh38)
Location 2:13357928-13357950
Sequence TATCTCTGTTTCACAAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926478494_926478495 -10 Left 926478494 2:13357928-13357950 CCAATCTTTGTGAAACAGAGATA No data
Right 926478495 2:13357941-13357963 AACAGAGATACATGACCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926478494 Original CRISPR TATCTCTGTTTCACAAAGAT TGG (reversed) Intergenic