ID: 926478495

View in Genome Browser
Species Human (GRCh38)
Location 2:13357941-13357963
Sequence AACAGAGATACATGACCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926478490_926478495 18 Left 926478490 2:13357900-13357922 CCAAATTAAGTAAATAAGACACC No data
Right 926478495 2:13357941-13357963 AACAGAGATACATGACCTTTTGG No data
926478489_926478495 21 Left 926478489 2:13357897-13357919 CCACCAAATTAAGTAAATAAGAC No data
Right 926478495 2:13357941-13357963 AACAGAGATACATGACCTTTTGG No data
926478494_926478495 -10 Left 926478494 2:13357928-13357950 CCAATCTTTGTGAAACAGAGATA No data
Right 926478495 2:13357941-13357963 AACAGAGATACATGACCTTTTGG No data
926478493_926478495 -3 Left 926478493 2:13357921-13357943 CCAGGGACCAATCTTTGTGAAAC No data
Right 926478495 2:13357941-13357963 AACAGAGATACATGACCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926478495 Original CRISPR AACAGAGATACATGACCTTT TGG Intergenic