ID: 926479843

View in Genome Browser
Species Human (GRCh38)
Location 2:13378073-13378095
Sequence AGATATGCTCTGCAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926479843_926479847 13 Left 926479843 2:13378073-13378095 CCTCCCCACTGCAGAGCATATCT No data
Right 926479847 2:13378109-13378131 GTACAAAAAGCCCTGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926479843 Original CRISPR AGATATGCTCTGCAGTGGGG AGG (reversed) Intergenic
No off target data available for this crispr