ID: 926481526

View in Genome Browser
Species Human (GRCh38)
Location 2:13402796-13402818
Sequence ATGATCAAGTGGAATTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926481524_926481526 22 Left 926481524 2:13402751-13402773 CCATAAAGGAGATACAATCAATA No data
Right 926481526 2:13402796-13402818 ATGATCAAGTGGAATTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926481526 Original CRISPR ATGATCAAGTGGAATTAAGA TGG Intergenic
No off target data available for this crispr