ID: 926502066

View in Genome Browser
Species Human (GRCh38)
Location 2:13668052-13668074
Sequence ACGCAGATACAGATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926502063_926502066 21 Left 926502063 2:13668008-13668030 CCAATATGGCTGGCATTCTTAAA No data
Right 926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG No data
926502064_926502066 -8 Left 926502064 2:13668037-13668059 CCAGAAGACAGAAACACGCAGAT No data
Right 926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926502066 Original CRISPR ACGCAGATACAGATGGACAA TGG Intergenic
No off target data available for this crispr