ID: 926502066 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:13668052-13668074 |
Sequence | ACGCAGATACAGATGGACAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926502063_926502066 | 21 | Left | 926502063 | 2:13668008-13668030 | CCAATATGGCTGGCATTCTTAAA | No data | ||
Right | 926502066 | 2:13668052-13668074 | ACGCAGATACAGATGGACAATGG | No data | ||||
926502064_926502066 | -8 | Left | 926502064 | 2:13668037-13668059 | CCAGAAGACAGAAACACGCAGAT | No data | ||
Right | 926502066 | 2:13668052-13668074 | ACGCAGATACAGATGGACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926502066 | Original CRISPR | ACGCAGATACAGATGGACAA TGG | Intergenic | ||
No off target data available for this crispr |