ID: 926512832

View in Genome Browser
Species Human (GRCh38)
Location 2:13803594-13803616
Sequence TGGATTTCCCATAAAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926512832_926512836 6 Left 926512832 2:13803594-13803616 CCAGTTTTTTTATGGGAAATCCA No data
Right 926512836 2:13803623-13803645 CTAATACTATACAATGGCTTAGG No data
926512832_926512835 0 Left 926512832 2:13803594-13803616 CCAGTTTTTTTATGGGAAATCCA No data
Right 926512835 2:13803617-13803639 GGAAAGCTAATACTATACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926512832 Original CRISPR TGGATTTCCCATAAAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr