ID: 926516248

View in Genome Browser
Species Human (GRCh38)
Location 2:13850608-13850630
Sequence GATTCTCTCTCTGAGTAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926516248_926516249 13 Left 926516248 2:13850608-13850630 CCACGCTACTCAGAGAGAGAATC No data
Right 926516249 2:13850644-13850666 AAGAGAGAGCACAGTAATTGTGG No data
926516248_926516251 26 Left 926516248 2:13850608-13850630 CCACGCTACTCAGAGAGAGAATC No data
Right 926516251 2:13850657-13850679 GTAATTGTGGGACTTTGCATTGG No data
926516248_926516250 14 Left 926516248 2:13850608-13850630 CCACGCTACTCAGAGAGAGAATC No data
Right 926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926516248 Original CRISPR GATTCTCTCTCTGAGTAGCG TGG (reversed) Intergenic
No off target data available for this crispr