ID: 926516250

View in Genome Browser
Species Human (GRCh38)
Location 2:13850645-13850667
Sequence AGAGAGAGCACAGTAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926516248_926516250 14 Left 926516248 2:13850608-13850630 CCACGCTACTCAGAGAGAGAATC No data
Right 926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926516250 Original CRISPR AGAGAGAGCACAGTAATTGT GGG Intergenic
No off target data available for this crispr