ID: 926516583

View in Genome Browser
Species Human (GRCh38)
Location 2:13853806-13853828
Sequence TTCCCAGAATAACACAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926516580_926516583 21 Left 926516580 2:13853762-13853784 CCATATTTACAGTTGAAACAGAT No data
Right 926516583 2:13853806-13853828 TTCCCAGAATAACACAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926516583 Original CRISPR TTCCCAGAATAACACAGAAG TGG Intergenic
No off target data available for this crispr