ID: 926518750

View in Genome Browser
Species Human (GRCh38)
Location 2:13883412-13883434
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926518741_926518750 30 Left 926518741 2:13883359-13883381 CCAATTCCCTGGTAGTGCAGTGT No data
Right 926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG No data
926518744_926518750 23 Left 926518744 2:13883366-13883388 CCTGGTAGTGCAGTGTGGCACAG No data
Right 926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG No data
926518743_926518750 24 Left 926518743 2:13883365-13883387 CCCTGGTAGTGCAGTGTGGCACA No data
Right 926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type