ID: 926519610

View in Genome Browser
Species Human (GRCh38)
Location 2:13895036-13895058
Sequence TTGTATATGTATATGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926519605_926519610 1 Left 926519605 2:13895012-13895034 CCACCAAGCTGTTTCCTCAGCTA No data
Right 926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG No data
926519606_926519610 -2 Left 926519606 2:13895015-13895037 CCAAGCTGTTTCCTCAGCTAATT No data
Right 926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926519610 Original CRISPR TTGTATATGTATATGGTGGT TGG Intergenic
No off target data available for this crispr