ID: 926523050

View in Genome Browser
Species Human (GRCh38)
Location 2:13941851-13941873
Sequence AGGCCTGATGGTCCACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926523050_926523056 24 Left 926523050 2:13941851-13941873 CCATCTGGTGGACCATCAGGCCT No data
Right 926523056 2:13941898-13941920 TAGGAAAGGTAAGAAGAGCTTGG No data
926523050_926523055 10 Left 926523050 2:13941851-13941873 CCATCTGGTGGACCATCAGGCCT No data
Right 926523055 2:13941884-13941906 TATGACTTTAGTGATAGGAAAGG No data
926523050_926523054 5 Left 926523050 2:13941851-13941873 CCATCTGGTGGACCATCAGGCCT No data
Right 926523054 2:13941879-13941901 TGGCTTATGACTTTAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926523050 Original CRISPR AGGCCTGATGGTCCACCAGA TGG (reversed) Intergenic
No off target data available for this crispr