ID: 926524188

View in Genome Browser
Species Human (GRCh38)
Location 2:13955926-13955948
Sequence CAGTCTCCCCAATTAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926524188_926524191 23 Left 926524188 2:13955926-13955948 CCAACTTTTAATTGGGGAGACTG No data
Right 926524191 2:13955972-13955994 TCCTGTTCCATTTGATATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926524188 Original CRISPR CAGTCTCCCCAATTAAAAGT TGG (reversed) Intergenic
No off target data available for this crispr