ID: 926525649

View in Genome Browser
Species Human (GRCh38)
Location 2:13976669-13976691
Sequence ATGTAGATAAATAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926525647_926525649 0 Left 926525647 2:13976646-13976668 CCACAGACTGAATGAGGTTACTT No data
Right 926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926525649 Original CRISPR ATGTAGATAAATAAGGAAGA AGG Intergenic
No off target data available for this crispr