ID: 926528569

View in Genome Browser
Species Human (GRCh38)
Location 2:14012489-14012511
Sequence CCAGTGTTGAAATGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926528558_926528569 30 Left 926528558 2:14012436-14012458 CCTCCCGTGAGGGGTTGAGCACA No data
Right 926528569 2:14012489-14012511 CCAGTGTTGAAATGGCTGGCTGG No data
926528560_926528569 26 Left 926528560 2:14012440-14012462 CCGTGAGGGGTTGAGCACAGTGG No data
Right 926528569 2:14012489-14012511 CCAGTGTTGAAATGGCTGGCTGG No data
926528559_926528569 27 Left 926528559 2:14012439-14012461 CCCGTGAGGGGTTGAGCACAGTG No data
Right 926528569 2:14012489-14012511 CCAGTGTTGAAATGGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926528569 Original CRISPR CCAGTGTTGAAATGGCTGGC TGG Intergenic
No off target data available for this crispr