ID: 926537894

View in Genome Browser
Species Human (GRCh38)
Location 2:14136054-14136076
Sequence ATGGTCAAGTTTAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926537891_926537894 0 Left 926537891 2:14136031-14136053 CCACTTTAAATCAAAAGTCAGAA No data
Right 926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926537894 Original CRISPR ATGGTCAAGTTTAGTGAGGA AGG Intergenic
No off target data available for this crispr