ID: 926539474

View in Genome Browser
Species Human (GRCh38)
Location 2:14157178-14157200
Sequence TCATATTCCCACTATGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926539471_926539474 -3 Left 926539471 2:14157158-14157180 CCAGTTGAATCCCAACTGAGTCA No data
Right 926539474 2:14157178-14157200 TCATATTCCCACTATGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926539474 Original CRISPR TCATATTCCCACTATGTGAC AGG Intergenic
No off target data available for this crispr