ID: 926541017

View in Genome Browser
Species Human (GRCh38)
Location 2:14182033-14182055
Sequence GCAAACTCTGGCCCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926541017_926541021 16 Left 926541017 2:14182033-14182055 CCAGCCTGTGGGCCAGAGTTTGC No data
Right 926541021 2:14182072-14182094 AATTGCATTAAATATTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926541017 Original CRISPR GCAAACTCTGGCCCACAGGC TGG (reversed) Intergenic