ID: 926541017 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:14182033-14182055 |
Sequence | GCAAACTCTGGCCCACAGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926541017_926541021 | 16 | Left | 926541017 | 2:14182033-14182055 | CCAGCCTGTGGGCCAGAGTTTGC | No data | ||
Right | 926541021 | 2:14182072-14182094 | AATTGCATTAAATATTACTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926541017 | Original CRISPR | GCAAACTCTGGCCCACAGGC TGG (reversed) | Intergenic | ||