ID: 926545128

View in Genome Browser
Species Human (GRCh38)
Location 2:14230567-14230589
Sequence TTGTATGTGGCTATAGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1308
Summary {0: 1, 1: 0, 2: 11, 3: 162, 4: 1134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926545125_926545128 -4 Left 926545125 2:14230548-14230570 CCATATTCCTAGGTATTTTTTGT 0: 1
1: 0
2: 9
3: 88
4: 553
Right 926545128 2:14230567-14230589 TTGTATGTGGCTATAGTGAATGG 0: 1
1: 0
2: 11
3: 162
4: 1134
926545124_926545128 5 Left 926545124 2:14230539-14230561 CCTGGTGAGCCATATTCCTAGGT 0: 1
1: 5
2: 53
3: 547
4: 1695
Right 926545128 2:14230567-14230589 TTGTATGTGGCTATAGTGAATGG 0: 1
1: 0
2: 11
3: 162
4: 1134
926545122_926545128 6 Left 926545122 2:14230538-14230560 CCCTGGTGAGCCATATTCCTAGG 0: 1
1: 7
2: 73
3: 723
4: 2767
Right 926545128 2:14230567-14230589 TTGTATGTGGCTATAGTGAATGG 0: 1
1: 0
2: 11
3: 162
4: 1134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926545128 Original CRISPR TTGTATGTGGCTATAGTGAA TGG Intergenic
900699710 1:4038360-4038382 ATTTTTGTGGCTATTGTGAAAGG - Intergenic
900734460 1:4287859-4287881 ATTTTTGTGGCTATTGTGAATGG + Intergenic
900904975 1:5550273-5550295 TTGTATATGGTTATAGGTAAGGG - Intergenic
903289653 1:22300747-22300769 GTGTGTGTGGCAATTGTGAATGG - Intergenic
905328108 1:37172380-37172402 TTGTATGTGGTTAAAATGATTGG - Intergenic
906557740 1:46728005-46728027 TTACATGTGGCTATTGTAAATGG - Intergenic
906585438 1:46972685-46972707 CTTTTTGTGGCTATTGTGAATGG + Intergenic
906836661 1:49090478-49090500 TCTTTTGTGGCTATTGTGAATGG - Intronic
906958870 1:50402137-50402159 TTTTTTGTGGCAATTGTGAATGG - Intergenic
906962894 1:50430159-50430181 TTTTATGTAGCTATTGTGAATGG + Intergenic
907001199 1:50859499-50859521 TTCTTTGTGGCTATTGTAAATGG - Intronic
907008384 1:50939314-50939336 TTCTTTGTGGCTATTGTAAATGG + Intronic
907014403 1:50997694-50997716 TTATTTGTGGCTATTGTAAATGG - Intergenic
907027545 1:51136048-51136070 TTTTTTGTGGCAATTGTGAATGG - Intronic
907591547 1:55677381-55677403 TTATTTGTGGCTATTGTAAATGG + Intergenic
907733514 1:57089889-57089911 TTGTGTGTAGGTATAGTCAAGGG - Intronic
908226763 1:62063752-62063774 TTTTGTGTGGCTATTGTAAATGG + Intronic
908464458 1:64378297-64378319 TTTTTTGTGGCTATTGTAAATGG + Intergenic
908593260 1:65656339-65656361 TTCTTTGTGGCAATTGTGAATGG - Intergenic
908707636 1:66977080-66977102 CTGTATGTGCTTATACTGAATGG - Intronic
908847154 1:68336498-68336520 TTGTGTGTGGCTATTGTAAATGG + Intergenic
908864750 1:68534606-68534628 TTTTTTGTGGCTATTGTGAATGG - Intergenic
908868443 1:68579071-68579093 TTTTTTGTGGCTATTGTAAATGG - Intergenic
909187972 1:72513742-72513764 TTGTATGTGGCTAGAGAAAGAGG - Intergenic
909264022 1:73533573-73533595 GTGTGTGTGGCTATTGTGAATGG + Intergenic
909304875 1:74061173-74061195 CTTTTTGTGGCTATTGTGAATGG - Intronic
909702990 1:78548670-78548692 GTGTGTGTGGCTATTGTAAATGG - Intergenic
909703880 1:78557663-78557685 TTTTTTGTGGCTATTGTAAATGG - Intergenic
909861888 1:80616977-80616999 TTTTGTGTGGCTATTGTAAATGG - Intergenic
910136857 1:83982542-83982564 TTGTGTGTGGCTATTGTAAATGG - Intronic
910230338 1:84980066-84980088 TTATTTGTGGCTATTGTAAATGG - Intronic
910331591 1:86078704-86078726 TTATGTGTGGCTATTGTAAATGG - Intronic
910378900 1:86604098-86604120 TTATTTGTGGCTATTGTAAATGG + Intergenic
910385515 1:86678476-86678498 TTTTTTGTGGCTATTGTAAATGG - Intergenic
910736369 1:90462407-90462429 CTTTTTGTGGCTATTGTGAATGG - Intergenic
911374846 1:97039686-97039708 CTTTTTGTGGCTATTGTGAATGG + Intergenic
911510061 1:98800516-98800538 TTGTATGTGGTTAAAGGCAAGGG + Intergenic
911675256 1:100651507-100651529 TTTTTTGTGGCAATTGTGAATGG - Intergenic
911853415 1:102847663-102847685 TTATATGTGGCTATTGTGAATGG - Intergenic
911887478 1:103322461-103322483 TTATATGTGGCTATTGTAAATGG + Intergenic
911929309 1:103881775-103881797 TTTTTTGTGGCTATTGTAAATGG - Intergenic
911940663 1:104043360-104043382 TTTTTTGTGGCTATTGTGAATGG + Intergenic
911942608 1:104067138-104067160 TTATTTGTGGCTATTGTAAATGG + Intergenic
911975923 1:104494640-104494662 TTGTTTGTAGCTATTGTAAATGG - Intergenic
912059332 1:105646062-105646084 TTATGTGTGGCTATTGTAAATGG - Intergenic
912275438 1:108253279-108253301 CTCTTTGTGGCTATTGTGAATGG - Intergenic
912292786 1:108441069-108441091 CTCTTTGTGGCTATTGTGAATGG + Intronic
912606638 1:110997190-110997212 TTATTTGTGGCTATTGTAAATGG + Intergenic
912644254 1:111376468-111376490 TTATTTGTGGCTATTGTAAATGG - Intergenic
912857468 1:113182877-113182899 TTTTTTGTGGCTATTGTAAATGG - Intergenic
912960901 1:114195105-114195127 TTATTTGTGGCTATTGTAAATGG + Intergenic
914985576 1:152454338-152454360 GTGTGTGTGGCTATTGTGAATGG + Intergenic
915085184 1:153382522-153382544 TTGTGTGTGGCTGTTGTAAATGG - Intergenic
915806018 1:158851540-158851562 TTCTTTGTGGCTATTGTAAATGG - Intergenic
915817375 1:158982889-158982911 CTTTGTGTGGCTATTGTGAAAGG + Intergenic
915857259 1:159402502-159402524 TTATGTGTGGCTATTGTAAATGG - Intergenic
916369106 1:164069217-164069239 TTATATGTGGCTATTATTAACGG + Intergenic
916386517 1:164278851-164278873 GTGTGTGTGGCTATTGTAAATGG - Intergenic
916516286 1:165520142-165520164 GTGTGTGTGGCTATTGTAAATGG + Intergenic
916807762 1:168276115-168276137 TTTTTTGTGGCTATTGTGAATGG + Intergenic
916909567 1:169331708-169331730 TTATTTGTGGCTATTGTAAATGG - Intronic
916998138 1:170323940-170323962 CTTTTTGTGGCTATTGTGAATGG + Intergenic
917257450 1:173131015-173131037 TTGTCTGTAGCAATTGTGAATGG + Intergenic
917298092 1:173543245-173543267 TTCTTTGTAGCAATAGTGAATGG - Intronic
917400278 1:174641221-174641243 TTTTCTGTGGCTCTGGTGAAAGG + Intronic
917407888 1:174728365-174728387 GTGTGTGTGGCTATTGTAAAGGG - Intronic
917583456 1:176399625-176399647 TTATATGTGGTTATTGTAAATGG + Intergenic
918273229 1:182924127-182924149 GTGTGTGTGGCCATTGTGAATGG - Intronic
918515975 1:185363693-185363715 TTTTCTGTGGCTATTGTGAATGG - Intergenic
918655626 1:187022532-187022554 TTGTTTGTGGCTATTATAAATGG - Intergenic
918861239 1:189829131-189829153 TTATTTGTGGCTATTGTGAAAGG - Intergenic
918938789 1:190962134-190962156 TTGTGTGTGGCTATTGTGAATGG - Intergenic
919200825 1:194353258-194353280 ATGTATGTGGTGATGGTGAATGG - Intergenic
919203677 1:194392494-194392516 CTTTTTGTGGCAATAGTGAATGG - Intergenic
919208809 1:194453443-194453465 TTGAATGTGGCATTATTGAAAGG + Intergenic
919316491 1:195977169-195977191 TTATTTGTGGCTATTGTAAATGG + Intergenic
919325592 1:196102257-196102279 TTATGTGTGGCTATTGTAAATGG - Intergenic
919337112 1:196249844-196249866 TTATTTGTGGCTATTGTAAATGG - Intronic
919368455 1:196695756-196695778 TTCTTTGTGGCAATTGTGAATGG + Intronic
919477785 1:198050747-198050769 TTATTTGTGGCTATTGTAAATGG + Intergenic
919576824 1:199320632-199320654 TTTTTTGTGGCAATTGTGAACGG + Intergenic
919578492 1:199341141-199341163 TTTTTTGTGGCAATTGTGAATGG - Intergenic
919722229 1:200850361-200850383 TTGAATGTTACTATAGTTAATGG - Intronic
920592801 1:207237967-207237989 TTGTTTGTGGCTATTGTAAATGG - Intergenic
920984722 1:210875882-210875904 TTGTTTGTTGCTATCATGAATGG - Intronic
921044252 1:211462111-211462133 TTATGTGTGGCTATTGTAAATGG - Intergenic
921295754 1:213700805-213700827 TTATTTGTGGCTATGGTAAATGG + Intergenic
921666152 1:217874291-217874313 TGGAATGAGGCCATAGTGAAAGG + Intergenic
921942563 1:220857563-220857585 TTATATGTGCCTATTGTAAATGG + Intergenic
922014123 1:221625889-221625911 TTATTTGTGGCTATTGTAAATGG + Intergenic
922642566 1:227248505-227248527 TTATTTGTGGCTATTGTAAATGG - Intronic
922770257 1:228178052-228178074 TGTTATGTGGGTATAGTGCATGG + Exonic
922971403 1:229743739-229743761 GTTTTTGTGGCTATTGTGAATGG + Intergenic
923189769 1:231609450-231609472 TTTTTTGTGGCAATTGTGAATGG + Intronic
923423603 1:233845577-233845599 TTGAACGTGGCCATAATGAAAGG + Intergenic
924782457 1:247164495-247164517 CTTTTTGTGGCTATTGTGAATGG - Intronic
924886640 1:248225186-248225208 CTTTTTGTGGCTATTGTGAATGG + Intergenic
924935767 1:248768370-248768392 TTTTTTGTAGCTATTGTGAAAGG - Intergenic
1062933837 10:1370694-1370716 GTGTGTGTGGCTATTGTAAATGG - Intronic
1063859699 10:10294265-10294287 GTGTGTGTGTCTATGGTGAATGG + Intergenic
1064350466 10:14571620-14571642 TTATATGTTGTTATAGTGAGTGG - Intronic
1064632686 10:17333134-17333156 TTCTTTGTGGCAATTGTGAATGG - Intronic
1064696411 10:17970531-17970553 TTATTTGTGGCTATTGTAAATGG + Intronic
1065593348 10:27287968-27287990 TTGAATGTGGCTAGTGTGATTGG + Intergenic
1066679414 10:37922652-37922674 TTATCTGTGGCTATTGTAAATGG - Intergenic
1066753091 10:38679950-38679972 TTTTTTGTGGCTACTGTGAATGG - Intergenic
1067024469 10:42831915-42831937 TTGTATGTTGATATAGTTATGGG + Exonic
1067245770 10:44541598-44541620 TTCTTTGTGGCTATTGTAAATGG + Intergenic
1067799045 10:49345260-49345282 TTATGTGTGGCTATTGTAAATGG - Intergenic
1068264577 10:54629982-54630004 TTTTTTGTGGCTATTGTAAATGG - Intronic
1068822688 10:61396057-61396079 TTGTATTTGGCTACATTTAAAGG + Intergenic
1068850721 10:61736893-61736915 TTTTTTGTGGCTGTTGTGAATGG + Intronic
1068960534 10:62862558-62862580 TTGACTGTGGCTTTAATGAATGG + Intronic
1069052210 10:63807520-63807542 TTATTTGTGGCTATTGTAAATGG + Intergenic
1069068273 10:63968659-63968681 GTGTGTGTGGCTATTGTAAAAGG - Intergenic
1069155188 10:65020640-65020662 TTTCTTGTGGCTATTGTGAATGG - Intergenic
1069158854 10:65065142-65065164 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1069335431 10:67343505-67343527 TTATTTGTGGCTATTGTAAATGG + Intronic
1069349983 10:67513668-67513690 TTATATATGGCTATAATGAAAGG - Intronic
1069356584 10:67593508-67593530 CTTTTTGTGGCTATTGTGAATGG + Intronic
1070317489 10:75329159-75329181 TTTTGTGTAGCTATTGTGAATGG + Intergenic
1070516309 10:77210805-77210827 TTCTGTGTGGCTATTGTCAATGG - Intronic
1071022749 10:81078144-81078166 ATTTTTGTGGCTATCGTGAATGG + Intergenic
1071045948 10:81377642-81377664 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1071060723 10:81569191-81569213 TTGTGTGTGGCTGTAGCGAATGG - Intergenic
1071249209 10:83799399-83799421 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1071357771 10:84815372-84815394 TTTTCTGTGGCAATGGTGAATGG + Intergenic
1071667508 10:87575126-87575148 TTATTTGTGGCTATTGTAAATGG + Intergenic
1071825746 10:89323676-89323698 CTTTTTGTGGCTATTGTGAATGG - Intronic
1071875999 10:89843892-89843914 TTATATGTAGCTATCGTAAATGG + Intergenic
1071905276 10:90166697-90166719 TTATGTGTGGCTATTGTAAATGG + Intergenic
1072144862 10:92625818-92625840 GTTTTTGTGGCTATTGTGAATGG - Intronic
1072509622 10:96106831-96106853 TTTTTTGTTGCTATTGTGAATGG + Intergenic
1072819313 10:98540478-98540500 TTGTAAATGGCTTTAGAGAATGG - Intronic
1072839668 10:98757573-98757595 TTTTTTATGGCTATGGTGAATGG - Intronic
1072863152 10:99028386-99028408 TTATTTGTGGCTATTGTAAATGG - Intronic
1072883572 10:99252562-99252584 TTTTTTGTGGCTATTGTAAAGGG - Intergenic
1073018674 10:100422671-100422693 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1073019102 10:100426291-100426313 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1073655143 10:105406337-105406359 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1073816223 10:107210402-107210424 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1073872812 10:107885333-107885355 TTATTTGTAGCTATTGTGAAGGG - Intergenic
1073948447 10:108779622-108779644 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1074190715 10:111133400-111133422 TTTTTTGTGGCTAATGTGAATGG + Intergenic
1074214603 10:111372193-111372215 CTTTGTGTGGCTATTGTGAATGG - Intergenic
1074566391 10:114582256-114582278 GTGTGTGTGGCTATTGTAAATGG - Intronic
1074862459 10:117521870-117521892 TTTTGTTTTGCTATAGTGAATGG - Intergenic
1075195393 10:120353271-120353293 TTATTTGTAGCTATTGTGAATGG - Intergenic
1075211499 10:120495003-120495025 TTGTATGTGTGTATTGTGTATGG + Intronic
1075385535 10:122052778-122052800 GTGTGTGTGTCTATAGTGCAGGG + Intronic
1076609681 10:131715181-131715203 GTGTGTGTGGTTATTGTGAATGG + Intergenic
1077708007 11:4506803-4506825 TTGTTTGTGGCAATTGTGAATGG - Intergenic
1077763162 11:5125846-5125868 CTGTTTGTGGCTATTGTGAATGG - Intergenic
1077829701 11:5853120-5853142 TTGTTTGTGGCTATTGTAATTGG - Intronic
1078027885 11:7715622-7715644 TTGTATATGGTTATAAGGAAGGG + Intergenic
1078383934 11:10870701-10870723 TTGTTTGTAGCTATTGTAAATGG + Intergenic
1078517652 11:12037712-12037734 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1078694394 11:13616061-13616083 CTGTGTGTGGCTACTGTGAATGG + Intergenic
1078755674 11:14206621-14206643 TTTTTTGTGGCAATTGTGAATGG - Intronic
1079041213 11:17061977-17061999 TTATTTGTGGCTATTGTAAATGG - Intergenic
1079166419 11:18047918-18047940 TTATTTGTGGCTATTGTAAATGG - Intergenic
1079255418 11:18823990-18824012 TTGTGTGTGGCTCTTGTGAATGG + Intergenic
1079525072 11:21376796-21376818 TTTTGTGTGGCTATTGTAAATGG + Intronic
1079572221 11:21957805-21957827 TTATTTGTGGCTATTGTAAATGG - Intergenic
1079625645 11:22613680-22613702 TTATTTGTGGCTATTGTAAAGGG + Intergenic
1079661116 11:23037768-23037790 GTGTGTGTGGCTACTGTGAATGG - Intergenic
1079736046 11:23998761-23998783 TCTTTTGTGGCTATTGTGAATGG - Intergenic
1079748178 11:24159746-24159768 TTCTTTGTGGCTATTGTAAATGG - Intergenic
1079908315 11:26277240-26277262 TTGTGTGTGTGTTTAGTGAAAGG + Intergenic
1079920892 11:26433143-26433165 TTTTGTGTGGCAATTGTGAAAGG + Intronic
1079945535 11:26736207-26736229 TTCTTTGTGGCTATTGTAAATGG - Intergenic
1080440049 11:32285010-32285032 TTTTTTATGGCTATTGTGAATGG - Intergenic
1080616786 11:33951637-33951659 TTATATGTGGCTATTGTAAATGG - Intergenic
1080982561 11:37425568-37425590 TTGTCTGTGGTTATTGTAAATGG - Intergenic
1081903575 11:46651023-46651045 TTGTCTGTGGATATAAAGAATGG + Intronic
1082193286 11:49272758-49272780 ATGTGTGTGGCTATTGTGAATGG + Intergenic
1082732112 11:56811791-56811813 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1083071666 11:59990563-59990585 TTGTGTATGGCTATTGTAAATGG + Intergenic
1084515295 11:69634671-69634693 TAGTATCTTGCTATAGGGAAGGG - Intergenic
1084841865 11:71858878-71858900 TTTTGTGTGGCTATTGTAAATGG + Intergenic
1084924398 11:72500881-72500903 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1085243871 11:75081768-75081790 TTGTGTGTGGCTATTATAAATGG - Intergenic
1085365014 11:75932751-75932773 TTATTTGTAGCTATTGTGAATGG - Intronic
1085444877 11:76593853-76593875 CTGTCTGTGGCAATTGTGAATGG - Intergenic
1085901566 11:80706257-80706279 TTTTGTGTGCCTATTGTGAATGG - Intergenic
1085990193 11:81832788-81832810 TTTTTTGTAGCTATTGTGAATGG - Intergenic
1086057966 11:82670058-82670080 TTGTACATGGCTATTGTAAATGG - Intergenic
1086184339 11:83995792-83995814 TTGTATATGGCAATAGTTAGGGG - Intronic
1086378276 11:86223907-86223929 GTGTGTGTGGCAATTGTGAATGG - Intergenic
1086672856 11:89568424-89568446 ATGTGTGTGGCTATTGTGGATGG - Intergenic
1086748040 11:90454949-90454971 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1086768480 11:90729577-90729599 TTCTTTGTGGCAATAGTGAATGG + Intergenic
1086977902 11:93157630-93157652 CTTTATGTGGCAATTGTGAATGG - Intronic
1087018956 11:93583052-93583074 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1087378250 11:97370756-97370778 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1087489347 11:98803288-98803310 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1087596533 11:100261188-100261210 CTGTTTGTGGCAATTGTGAATGG - Intronic
1087694290 11:101358144-101358166 TTATTTGTGGCTATTGTAAATGG - Intergenic
1087918323 11:103835959-103835981 TTATTTGTGGCTATTGTGAATGG - Intergenic
1088029907 11:105235740-105235762 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1088086971 11:105993088-105993110 TTGTGTGTGGCTCTTGTAAATGG + Intergenic
1088364535 11:109025596-109025618 TTATTTGTGGCTATTGTAAATGG + Intergenic
1088730204 11:112673673-112673695 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1088736168 11:112729376-112729398 TTCTGTTTGGCTGTAGTGAATGG - Intergenic
1089062648 11:115638449-115638471 TTGAAGGTGGCTATAATGACAGG + Intergenic
1089824332 11:121260547-121260569 TTATTTGTGGCTATTGTAAATGG + Intergenic
1089996938 11:122917335-122917357 TTGTATGTGGCTAGATTGTGAGG + Intronic
1090143420 11:124291337-124291359 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1090175200 11:124642724-124642746 TTGTATATGGCAAAAGTGAAGGG + Intronic
1090317902 11:125812574-125812596 TTATTTGTGGCTATTGTAAATGG + Intergenic
1090630368 11:128641698-128641720 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1091521823 12:1253255-1253277 TTTTATGTGACTATACTGTAGGG + Intronic
1091598716 12:1902606-1902628 TTATTTGTGGCTATTGTAAATGG - Intronic
1092678053 12:10944327-10944349 GTGTGTGTGGCAATTGTGAATGG + Intronic
1093097661 12:14990155-14990177 TTGTGTGTGGCAATTTTGAATGG - Intergenic
1093322341 12:17728179-17728201 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1093419621 12:18959870-18959892 TTATTTGTGGCTATTGTAAATGG + Intergenic
1093476197 12:19557246-19557268 TTATTTGTGGCTATTGTAAATGG + Intronic
1093476808 12:19565045-19565067 CTTTTTGTGGCTATTGTGAATGG + Intronic
1093541705 12:20294993-20295015 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1093793566 12:23284843-23284865 TTATTTGTGGCTATTGTAAATGG - Intergenic
1093968341 12:25350873-25350895 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1094138809 12:27159055-27159077 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1094297912 12:28928532-28928554 GTGTCTGTGGATACAGTGAAGGG + Intergenic
1094686398 12:32720358-32720380 TTGTTTTTGTCTATAGTTAATGG + Intronic
1095519417 12:43044723-43044745 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1095675229 12:44909321-44909343 GTGTGTGTGGCTATTGTAAATGG - Intronic
1095891300 12:47236674-47236696 TTGCATGTGTCTATATTTAATGG + Intergenic
1096036077 12:48472094-48472116 TTCTTTGTGGCTATTGTAAATGG + Intergenic
1096048991 12:48589838-48589860 TTCTTTGTGGCTATTGTAAATGG - Intergenic
1096196183 12:49650235-49650257 TTGAATCTGGCTTTAGTGTAGGG - Intronic
1097146622 12:56943983-56944005 TTATTTGTGGCTATTGTAAATGG + Intergenic
1097320101 12:58216113-58216135 CTTTCTGTGGCTATTGTGAATGG + Intergenic
1097380426 12:58889217-58889239 TTGTTTGTGTCTATACTGAGTGG - Intronic
1097714309 12:62949757-62949779 TTATCTGTGGCTATTGTAAATGG + Intergenic
1097751857 12:63364027-63364049 TTATGTGTGGCTATTGTAAATGG + Intergenic
1097857304 12:64477409-64477431 CTGTGTGTGGCTATGGTAAATGG + Intronic
1097890963 12:64777499-64777521 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1098142580 12:67465591-67465613 TGATATGTGGCTATTGTAAATGG + Intergenic
1098327723 12:69319788-69319810 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1098736271 12:74109955-74109977 TTTTGTGTGGCAATTGTGAATGG - Intergenic
1098762388 12:74441238-74441260 TTATGTGTGGCTATTGTAAATGG - Intergenic
1099252980 12:80280946-80280968 GTGTGTATGGCTATTGTGAATGG + Intronic
1099265941 12:80448138-80448160 TTTTTTGTGGCTATCGTAAATGG + Intronic
1099463931 12:82959068-82959090 GTGTATATGGCTATTGTAAATGG - Intronic
1099792891 12:87359463-87359485 TTGTTTGTAGCAATTGTGAATGG + Intergenic
1099900536 12:88705560-88705582 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1100114884 12:91292441-91292463 TTGTTTGTGGGTTTTGTGAATGG + Intergenic
1100266641 12:92983064-92983086 GTGTCTGTGTCTATTGTGAATGG - Intergenic
1100628554 12:96362722-96362744 TTGTATGTGGTTAGAGCCAAGGG - Intronic
1100849359 12:98693176-98693198 TTGTGTGTGGCTACTGTAAATGG + Intronic
1100925252 12:99538502-99538524 TTATGTGTGGCTATTGTAAATGG + Intronic
1100943840 12:99756326-99756348 CTTTTTGTGGCTATTGTGAATGG - Intronic
1101215976 12:102583350-102583372 CTTTTTGTGACTATAGTGAATGG - Intergenic
1101220909 12:102639454-102639476 CTGTTTGTGGCTATTGTGAATGG - Intergenic
1101309999 12:103569011-103569033 TTGTATGTGGCTATTATAAATGG - Intergenic
1102939976 12:116931616-116931638 TTTGGTGTGGCTATTGTGAATGG + Intronic
1104155908 12:126131971-126131993 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1104186514 12:126437264-126437286 TTGTGTGTGGCTGTTGTGTAAGG - Intergenic
1104632553 12:130415946-130415968 GTGTGTGTGGCTATTGTCAATGG - Intronic
1104677682 12:130724966-130724988 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1105347108 13:19583959-19583981 TTATGTGTGGCTATTGTAAATGG + Intergenic
1105649747 13:22363003-22363025 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1105746769 13:23384422-23384444 TGGTAAGTGGTTATAGTGAGTGG - Intronic
1105990993 13:25620888-25620910 TTGTATGAAGCCATAGAGAAAGG + Intronic
1106294878 13:28403206-28403228 TTGTATGTGGTTATACAGAGAGG + Intronic
1106935706 13:34716579-34716601 TTTTTTGTGGCTATTGTCAATGG + Intergenic
1106963697 13:35033754-35033776 TTATGTGTGGCTATTGTAAATGG + Intronic
1106969777 13:35125537-35125559 ATCTCTGTGGCTATAGAGAAAGG + Intronic
1107211229 13:37857166-37857188 TTATGTGTGGCTATTGTAAATGG - Intronic
1107310999 13:39077793-39077815 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1107329924 13:39288216-39288238 TTTTCTGTGGCTATTGTAAATGG - Intergenic
1107389532 13:39949268-39949290 CTTTCTGTGGCTATTGTGAATGG - Intergenic
1107397913 13:40037365-40037387 TTTTATGTGGTGATGGTGAAAGG + Intergenic
1107567868 13:41625061-41625083 CTTTTTGTGGCTATTGTGAATGG - Intronic
1107568298 13:41629160-41629182 CTTTTTGTGGCTATTGTGAATGG - Intronic
1107570556 13:41653297-41653319 CTGTTTGTGGCTATTGTGAATGG - Intronic
1108031933 13:46240723-46240745 CTTTATGTGGCAATTGTGAATGG - Intronic
1108255521 13:48606403-48606425 TTATTTGTGGCTATTGTAAATGG + Intergenic
1108295044 13:49007721-49007743 GTGTAGATGGCTATAGAGAAAGG + Intronic
1108395591 13:49987978-49988000 TTGTGTGTGGCTACAGCGTAGGG - Intergenic
1108414873 13:50187488-50187510 TTGTAGGTTGTTATAGTGATGGG + Intronic
1108759808 13:53549220-53549242 TTTTTTGTTGCTATTGTGAATGG + Intergenic
1108776029 13:53766171-53766193 TTTTATGTGGCAATTGTGAATGG - Intergenic
1109078688 13:57870018-57870040 TTGTGTATGGCTATTGTAAATGG - Intergenic
1109112384 13:58337933-58337955 TTTTGTGTGGCTATTGTAAATGG + Intergenic
1109145591 13:58775184-58775206 TTCTTTGTGGCTATTGTAAACGG - Intergenic
1109748882 13:66664073-66664095 TTGTATGTGGCAAAAGGGATAGG - Intronic
1109904788 13:68826397-68826419 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1110334758 13:74314932-74314954 TTTTCTGTGGCAATTGTGAATGG + Intergenic
1110803770 13:79731465-79731487 TTTTCTGTGGCAATTGTGAATGG + Intergenic
1110888819 13:80672713-80672735 TTATGTGTGGCTATTGTAAATGG + Intergenic
1110899628 13:80804559-80804581 TTTTTTGTAGCTATTGTGAATGG - Intergenic
1110907846 13:80915625-80915647 TTGTGTGTGGCAATTGTGAATGG - Intergenic
1110981138 13:81899808-81899830 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1111022410 13:82469363-82469385 TTTTTTGTGGCTATTGTAAAAGG + Intergenic
1111040058 13:82736282-82736304 TTTTGTGTGGCTATTGTAAATGG + Intergenic
1111153410 13:84290169-84290191 TTCTTTGTGGTTATTGTGAATGG - Intergenic
1111335990 13:86824177-86824199 TTTTTTGTAGCTATTGTGAATGG - Intergenic
1112082737 13:95992438-95992460 TGGTGTGTGGCTATTGTAAATGG + Intronic
1112223054 13:97510843-97510865 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1112256980 13:97843303-97843325 TTGTATGTGGCTGGAAGGAAAGG - Intergenic
1112715040 13:102174524-102174546 TTGTGTGTGGCTATTGTAAATGG - Intronic
1112782822 13:102920170-102920192 TTTTTTATGGCTATTGTGAATGG + Intergenic
1112958613 13:105092792-105092814 TTATTTGTGGCTACTGTGAATGG + Intergenic
1113243502 13:108367269-108367291 GTGTGTGTGGCTATTGTGAATGG + Intergenic
1113305200 13:109070062-109070084 CTGTATGTGGCTAAAGACAATGG + Intronic
1113586080 13:111466812-111466834 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1113697993 13:112361863-112361885 TTTCTTGTGGCTATTGTGAATGG + Intergenic
1114368426 14:22056436-22056458 TTTTTTGTGGCTATGGTAAATGG + Intergenic
1114434462 14:22693331-22693353 TTTTGTGTGGCTATTGTAAATGG + Intergenic
1114687375 14:24546674-24546696 TTATGTGTGGCTATTGTAAATGG + Intergenic
1114747481 14:25165476-25165498 TTATTTGTGGCTATTGTAAATGG + Intergenic
1115009907 14:28533371-28533393 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1115021498 14:28686116-28686138 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1115105745 14:29759982-29760004 TTGCATGTGTTTATAGTCAACGG - Intronic
1115182497 14:30645576-30645598 CTTTTTGTGGCTATTGTGAATGG + Intronic
1115938856 14:38586378-38586400 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1116018966 14:39439002-39439024 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1116148386 14:41104626-41104648 TTGGATGTGGCTATTATGAATGG + Intergenic
1116302760 14:43206629-43206651 TTTTTTGTGGCTATAGCAAATGG + Intergenic
1116481508 14:45396839-45396861 TTGTTTGTAGCTATTGTAAATGG - Intergenic
1116666072 14:47777277-47777299 TTCTATATGGCTATTCTGAAGGG - Intergenic
1116796619 14:49397829-49397851 TTTTTTGTGGTTATTGTGAATGG - Intergenic
1116800071 14:49433949-49433971 CTTTCTGTGGCTATTGTGAATGG - Intergenic
1116810098 14:49531230-49531252 TTATTTGTGGCTATTGTAAATGG - Intergenic
1117002663 14:51386779-51386801 TTGTATGTGGCTGTAGACAATGG + Intergenic
1117259611 14:54017935-54017957 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1117264235 14:54069384-54069406 TTATATGTGGCTATGATAAATGG + Intergenic
1117317496 14:54587177-54587199 TTGTTTGCAGCTATTGTGAAAGG + Intronic
1117418627 14:55521627-55521649 TTATTTGTGGCTATTGTAAATGG - Intergenic
1117482682 14:56163806-56163828 TTATGTGTGGCTATTGTAAATGG + Intronic
1117662088 14:58017527-58017549 TTTTTTGTAGCTATTGTGAATGG - Intronic
1117785029 14:59274586-59274608 ATGTTTGTGGCTTGAGTGAATGG + Intronic
1117851841 14:59980720-59980742 TTTTATATTGCTATAATGAATGG + Intronic
1117888823 14:60395349-60395371 TTATTTGTGGCTATTGTAAATGG + Intergenic
1117941685 14:60973496-60973518 TTATATGTGGCCCTCGTGAATGG - Exonic
1118099246 14:62577469-62577491 TTATGTGTGGCTATTGTAAATGG - Intergenic
1118158637 14:63266652-63266674 TTTTGTGTGGCTATTGTAAATGG + Intronic
1118215651 14:63805730-63805752 GTGTGTGTGGCTATTGTGAATGG + Intergenic
1118538627 14:66797580-66797602 TTGTGTGTGGCTATTGTAAATGG + Intronic
1118543899 14:66863216-66863238 TTCTCTGTGGCTATTGTAAATGG - Intronic
1118666039 14:68071031-68071053 TTTTTTGTGGCTGTTGTGAATGG + Intronic
1118963142 14:70554158-70554180 TTATTTGTGGCTATTGTAAATGG - Intergenic
1120064428 14:80023799-80023821 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1120237797 14:81912836-81912858 TTGTTTGTAGCTATTGTAAATGG + Intergenic
1120262680 14:82206498-82206520 TTGTATATGGCAAGAGTTAAGGG + Intergenic
1120400804 14:84028846-84028868 GTGTATGTGTGTGTAGTGAATGG - Intergenic
1120480589 14:85044409-85044431 TGGCATATGGCAATAGTGAAGGG - Intergenic
1120609265 14:86620526-86620548 TTGTATGTGGCTTTCATGCATGG - Intergenic
1120774601 14:88420020-88420042 TGTTATGTGGCAAAAGTGAAGGG + Intronic
1121672133 14:95718743-95718765 TTTTTTGTAGCTATTGTGAATGG + Intergenic
1123453683 15:20394533-20394555 GTGTGTGTGGCAATTGTGAATGG + Intergenic
1123793051 15:23742183-23742205 TTGTGTGTGGCTATTATAAATGG - Intergenic
1124091246 15:26604157-26604179 TTATTTGTGGCTATTGTTAATGG - Intronic
1124353886 15:28980473-28980495 TTGTGTGTGGCGATTGTAAATGG - Intronic
1124416942 15:29480325-29480347 TTTTTTTTTGCTATAGTGAATGG - Intronic
1125059788 15:35405452-35405474 TTATTTGTGGCTATTGTAAATGG + Intronic
1125238532 15:37546307-37546329 TTGTGTGTGGCTATTCTAAATGG - Intergenic
1125808216 15:42513500-42513522 TTGTATGTGGCTAATTTGATAGG - Intronic
1125973073 15:43928093-43928115 TTTTATGTAGCTGTAGGGAATGG - Intronic
1126139721 15:45427486-45427508 TTGTATGTGGAAATATTTAAGGG - Intergenic
1126216589 15:46162346-46162368 TTATGTGTGGCTATTGTAAATGG - Intergenic
1126250360 15:46560469-46560491 TTATTTGTGGCTATTGTAAATGG + Intergenic
1126270030 15:46804969-46804991 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1126287607 15:47031590-47031612 TTGTGTGTGTCTATTGTAAATGG - Intergenic
1126496615 15:49298167-49298189 CTTTTTGTGGCTATTGTGAATGG + Intronic
1126519891 15:49581210-49581232 TTAAATGTGGCTAGAGAGAAGGG + Intronic
1126520233 15:49584749-49584771 GTGTCTGTGGCAATCGTGAATGG - Intronic
1126533821 15:49739030-49739052 TTGTATGTGGCTATTGCCAGTGG - Intergenic
1126968164 15:54079561-54079583 TTGTGTGTGGCTATTATAAATGG + Intronic
1126972155 15:54128156-54128178 TTCTTTGTGGCTATTGTAAATGG - Intronic
1127003407 15:54537218-54537240 GTGTATGTGGCTATTGTGAATGG - Intronic
1127145787 15:56022022-56022044 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1127330648 15:57936196-57936218 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1128900589 15:71417982-71418004 TTATTTGTAGCTATAGTAAATGG + Intronic
1129560065 15:76557000-76557022 TTTTTTGTGGCTATTGTGAATGG - Intronic
1129568995 15:76658302-76658324 TTTTTTGTGGCTATTGTGAATGG - Intronic
1129583281 15:76835171-76835193 GTGTGTGTGGCTATTGTGAATGG - Intronic
1129583332 15:76835917-76835939 TTTTTTGTGGCTAATGTGAATGG - Intronic
1130173118 15:81537635-81537657 TTATTTGTGGCTATTGTAAATGG - Intergenic
1130173158 15:81538229-81538251 TTGTATGTGGCAAGAGATAAGGG - Intergenic
1131190435 15:90311187-90311209 TTGTATGTGGTGAGAGAGAAGGG + Intronic
1133367222 16:5219801-5219823 TTCTATGTTGCTTTAGAGAATGG + Intergenic
1134821258 16:17249179-17249201 TTGAATGAGGGTATATTGAAGGG + Intronic
1135020406 16:18958155-18958177 TTGAACCTGGCTATAGTTAAGGG - Intergenic
1135677336 16:24427682-24427704 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1135800005 16:25484898-25484920 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1136650879 16:31669226-31669248 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1136660116 16:31750289-31750311 GTGTGTGTGGCTATTGTAAATGG + Intronic
1136673596 16:31879216-31879238 TTTTAATTGGCTATAGTCAAAGG - Intronic
1136729605 16:32397058-32397080 TTTTTTGTGGCTACTGTGAATGG + Intergenic
1136859205 16:33686490-33686512 TTGTATGTTGATATAGTTATGGG - Intergenic
1137374221 16:47938658-47938680 TTGTATGTGGCTACTGTAAATGG - Intergenic
1138006072 16:53338952-53338974 TTTTATGTGGCTAGAGAGTAAGG - Intergenic
1138258742 16:55597035-55597057 TTTTTTGTGGCTATTGTGAATGG - Intergenic
1138809767 16:60135367-60135389 GTGTATGTGGCTATTATAAACGG + Intergenic
1138976117 16:62210193-62210215 TTGTGTGTGGCAATTCTGAATGG + Intergenic
1139070456 16:63374891-63374913 TTATGTGTGGCTATTGTAAATGG - Intergenic
1139342940 16:66281861-66281883 TTTTGTGTGGCTATTGTAAATGG - Intergenic
1140431002 16:74902998-74903020 TTGTATGTGACTAAAATGAGTGG - Intronic
1141038201 16:80647099-80647121 TTATTTGTGGCTATTGTAAATGG - Intronic
1141038341 16:80649376-80649398 TTATTTGTGGCTATTGTAAATGG - Intronic
1141258754 16:82431080-82431102 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1202996791 16_KI270728v1_random:120236-120258 TTTTTTGTGGCTACTGTGAATGG - Intergenic
1203023478 16_KI270728v1_random:432578-432600 TTTTTTGTGGCTACTGTGAATGG - Intergenic
1203120714 16_KI270728v1_random:1534676-1534698 TTGTATGTTGATATAGTTATGGG - Intergenic
1142840798 17:2627828-2627850 TTATTTGTGGCTATTGTAAAAGG + Intronic
1143230399 17:5349149-5349171 TTGTGTCTGGCTTCAGTGAAGGG + Intronic
1143257387 17:5571495-5571517 TTTTTTGTGGCTATTGTGAATGG - Intronic
1144137414 17:12310735-12310757 TCTTTTGTGGCTATTGTGAATGG + Intergenic
1144399358 17:14880653-14880675 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1145726956 17:27138278-27138300 GTGTATGTGGCAATTATGAATGG - Intergenic
1146098204 17:29953274-29953296 TTTTTTGTGGCAATTGTGAATGG - Intronic
1148994290 17:51695421-51695443 TTGTGTGTGGCTATTGTAAGAGG + Intronic
1149112540 17:53050315-53050337 GTTTGTGTGGCTATTGTGAATGG - Intergenic
1149163060 17:53718191-53718213 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1149247815 17:54732085-54732107 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1149362246 17:55907959-55907981 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1150038033 17:61825606-61825628 TTATTTGTGGCAATTGTGAATGG - Intronic
1150900100 17:69264287-69264309 TTTTTTGTGGCTATTGTAAATGG + Intronic
1151817436 17:76478214-76478236 TTTGATGTGGTTTTAGTGAAGGG - Intronic
1152326249 17:79640205-79640227 TTTTTTGTTGCTATTGTGAATGG - Intergenic
1153349710 18:4065563-4065585 TTTTTTGTGGCTACTGTGAATGG - Intronic
1153399820 18:4671315-4671337 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1153446956 18:5184582-5184604 TTTTTTGTGTCTATTGTGAATGG - Intronic
1153672504 18:7425632-7425654 CTTTATGTGGCTACTGTGAATGG + Intergenic
1154061879 18:11069911-11069933 TTATTTGTAGCTATTGTGAATGG - Intronic
1154371798 18:13770138-13770160 TTTTTTGTAGCTATTGTGAATGG - Intergenic
1154392937 18:13957664-13957686 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1155105650 18:22663172-22663194 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1155282730 18:24256850-24256872 TTATGTGTGGCTATTGTAAATGG - Intronic
1155480296 18:26279262-26279284 GTGTGTGTGGCTATTGTAAATGG - Intronic
1155534267 18:26800315-26800337 TCATATGTGGCTATTGTAAAAGG - Intergenic
1155650976 18:28141331-28141353 GTGTATGAGGCTACAGGGAAGGG + Intronic
1155769332 18:29676938-29676960 TTTTTTGTGGCTATTGTGAATGG - Intergenic
1155779725 18:29815808-29815830 TTTATTGTGGCTATTGTGAATGG - Intergenic
1156025544 18:32650148-32650170 TTATGTGTGGCTATTGTAAATGG + Intergenic
1156170001 18:34471334-34471356 TTCTTTGTGGCTATTGTAAATGG + Intergenic
1156382430 18:36576468-36576490 TTGTATGTGGATGGAATGAATGG + Exonic
1156429191 18:37052736-37052758 GTGTGTGTGGCTATTGTAAATGG - Intronic
1156584602 18:38417921-38417943 TTGTATGTGGCTCTAGTGACAGG - Intergenic
1156699692 18:39810696-39810718 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1156826859 18:41440378-41440400 CTTTTTGTGGCTATTGTGAAAGG + Intergenic
1157886765 18:51375525-51375547 TTATTTGTGGCTATTGTAAATGG - Intergenic
1158024703 18:52882044-52882066 TTATGTGTGGCTATGGTAAATGG + Intronic
1158331310 18:56366093-56366115 TTGTGTGTGGCTATTGTAAAAGG + Intergenic
1158431788 18:57395162-57395184 TTATTTGTGGCTATTGTAAATGG - Intergenic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1158812794 18:61057125-61057147 TTGGATTTGGCCATAGGGAATGG + Intergenic
1158948643 18:62470629-62470651 TTATATGTGGCTATTTTAAATGG + Intergenic
1159403763 18:67973396-67973418 TTTTTTGTTGCTATTGTGAATGG + Intergenic
1159855044 18:73576555-73576577 TTTTTTGTAGCTATTGTGAATGG + Intergenic
1159856707 18:73597994-73598016 TGGAGTGTGGCTATAATGAAAGG + Intergenic
1159896177 18:73998061-73998083 TTATTTGTGGCTATTGTAAATGG + Intergenic
1159996132 18:74966904-74966926 TTATTTGTGGCTATTGTAAATGG + Intronic
1160016686 18:75147672-75147694 TTTTGTGTGGCTATTGTAAATGG + Intergenic
1160467379 18:79091530-79091552 TTATGTGTGGCTATTGTAAATGG + Intronic
1163181201 19:15604088-15604110 TCTTTTGTGGCTATTGTGAATGG + Intergenic
1164069753 19:21756477-21756499 GTGTGTGTGGCAATTGTGAATGG - Intronic
1164390699 19:27817943-27817965 CTTTTTGTGGCAATAGTGAATGG + Intergenic
1165366408 19:35369832-35369854 TTGTGTGTGGCTATTGTAATTGG - Intergenic
1166009337 19:39929815-39929837 TTATTTGTGGCTATTGTAAATGG - Intronic
1166176102 19:41071675-41071697 TCTTTTGTGGCTATTGTGAATGG + Intergenic
1166974263 19:46594893-46594915 TTCTTTGTGGCTATTGTAAATGG - Intronic
1168018349 19:53591443-53591465 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1168117955 19:54235530-54235552 TTGTTTGTGGCTATTATAAATGG + Intronic
925021357 2:571616-571638 TTGTATATGGCAAAAGAGAAGGG - Intergenic
925088057 2:1127709-1127731 ATGTGTGTGGCTATTGTAAATGG + Intronic
925192397 2:1895097-1895119 TTCTTTGTGGCTACTGTGAATGG - Intronic
925232704 2:2249262-2249284 TTATTTGTGGCTACAGTGAGTGG - Intronic
925457930 2:4033156-4033178 TTCTTTGTGGCTATTGTAAATGG + Intergenic
925672117 2:6322047-6322069 TTTTTTGTGGCTATGGTAAATGG - Intergenic
926432237 2:12799717-12799739 TTTTTTGTGGCAATTGTGAATGG - Intergenic
926481613 2:13404721-13404743 GTGTGTGTGGCAATTGTGAATGG - Intergenic
926538399 2:14143427-14143449 TTTTTTGTGGCTATTGTGAATGG + Intergenic
926545128 2:14230567-14230589 TTGTATGTGGCTATAGTGAATGG + Intergenic
926549031 2:14278763-14278785 TTTTTTGTGGCTATTGTGAATGG + Intergenic
927016428 2:18967343-18967365 GTGTTTGTGGCTATTGTAAATGG + Intergenic
927127870 2:20029579-20029601 TCTTTTGTGGCTATTGTGAATGG - Intergenic
927309423 2:21612777-21612799 TTATGTGTGGCTATTGTAAATGG + Intergenic
927425038 2:22971937-22971959 TTATGTGTGGCTATTGTAAATGG - Intergenic
928142473 2:28742053-28742075 TTTTGTGTGGCAATTGTGAACGG + Intergenic
928490951 2:31782612-31782634 GTGTGTGTGGCAATTGTGAATGG - Intergenic
928491588 2:31789608-31789630 TTATTTGTAGCTATAGTAAATGG - Intergenic
928525819 2:32139512-32139534 TTCTTTGTGGCTATTGTAAATGG - Intronic
928785989 2:34887014-34887036 ATATTTGTGGCTATAGTAAATGG + Intergenic
929525048 2:42693819-42693841 CTATAGGTGGCTATGGTGAAAGG - Intronic
929540913 2:42820126-42820148 TTATGTGTGGCTATTGTAAATGG + Intergenic
930047289 2:47183958-47183980 GTGTATGTGTGTATAGAGAAAGG - Intergenic
930210357 2:48630368-48630390 TTGTGTGTGGCTATTGCAAATGG + Intronic
930212062 2:48651125-48651147 TTGTATGTGGCTTCTGTGACTGG - Intronic
930527206 2:52545131-52545153 TTATGTGTGGCTATTGTAAATGG + Intergenic
930898010 2:56468501-56468523 GTGTCTGTGGCTATTGTAAATGG - Intergenic
931085557 2:58826388-58826410 TTATTTGTGGCTATTGTAAATGG + Intergenic
931539733 2:63316936-63316958 CTTTTTGTGGCTATTGTGAATGG - Intronic
931549673 2:63428783-63428805 CTTTTTGTGGCTATTGTGAATGG - Intronic
931568502 2:63642550-63642572 TTATTTGTGGCTATTGTAAATGG + Intronic
931576869 2:63726797-63726819 TTTTGTGTGGCTATGGTGAATGG + Intronic
931765122 2:65448554-65448576 TTATGTGTGGCTATTGTAAATGG + Intergenic
931779973 2:65571013-65571035 TTGTGTGTGGCTATTGTGAATGG + Intergenic
931824110 2:65981665-65981687 CTGTATATGACTATAGTGAGAGG - Intergenic
932648124 2:73526536-73526558 TTATGTGTGGCTATTGTAAATGG + Intronic
933163114 2:79048051-79048073 TTATTTGTGGCTATTGTAAATGG - Intergenic
933275704 2:80281478-80281500 GTGTCTGTGGGTATAGTCAAAGG + Intronic
934149531 2:89132331-89132353 TTTTCTGTGGCTATTGTGAATGG - Intergenic
934185908 2:89675101-89675123 TTTTTTGTGGCTACTGTGAATGG + Intergenic
934217764 2:90049697-90049719 TTTTCTGTGGCTATTGTGAATGG + Intergenic
934842103 2:97632381-97632403 TTATGTGTGGCTATTGTAAATGG + Intergenic
934980371 2:98834273-98834295 TTGAATATTGCTGTAGTGAATGG - Intronic
935116429 2:100140822-100140844 TTGTCTGTAGCTACAGTGTAAGG + Intronic
935356223 2:102202634-102202656 TTATGTGTGGCTATTGTAAATGG + Intronic
935437494 2:103051223-103051245 TTATTTGTGGCTATTGTGAATGG + Intergenic
935532978 2:104258052-104258074 TTATATGTGGCTATTGTAAGTGG - Intergenic
936120548 2:109739472-109739494 TTATGTGTGGCTATTGCGAATGG + Intergenic
936150141 2:110013282-110013304 TTTTATGTGGCCATAATAAATGG + Intergenic
936224147 2:110631974-110631996 TTATGTGTGGCTATTGTGAATGG - Intergenic
936247512 2:110841387-110841409 TTACCTGTGGCTATAGCGAATGG - Exonic
936812394 2:116417808-116417830 CTTTCTGTGGCTATTGTGAATGG - Intergenic
936857232 2:116973657-116973679 GTGTGTGTGGCTATTGTGAATGG + Intergenic
936869653 2:117120117-117120139 TTGTTTGTAGCTATTGTAAATGG + Intergenic
937194396 2:120138575-120138597 TTATTTGTGGCTATTGTAAATGG - Intronic
937498923 2:122456329-122456351 TTTTCTGTGGCTATTGTAAATGG - Intergenic
937561268 2:123227162-123227184 TCTTTTGTGGCTATCGTGAATGG + Intergenic
937617999 2:123949520-123949542 TTATGTGTGGCTATTGTAAATGG - Intergenic
937679722 2:124630965-124630987 TTCTTTGTGGCAATTGTGAATGG - Intronic
937723353 2:125129212-125129234 CTTTGTGTGGCTATTGTGAATGG - Intergenic
937753084 2:125501469-125501491 CTTTCTGTGGCTATTGTGAATGG + Intergenic
938165673 2:129024084-129024106 TTGTGTATGGCAATTGTGAATGG + Intergenic
938180469 2:129177781-129177803 TTGTATGTCACTTTATTGAATGG - Intergenic
938313972 2:130314016-130314038 TTGTTTGTGGCAATAGAGAAGGG + Intergenic
938635420 2:133220488-133220510 TAGTCTGGGGCTATATTGAAGGG - Intronic
938865056 2:135409866-135409888 GTGTGTGTGGCTATTGTAAATGG - Intronic
938942542 2:136181652-136181674 ATGTTTGTTGGTATAGTGAAAGG + Intergenic
939089432 2:137761547-137761569 TCTTTTGTGGCTATTGTGAATGG - Intergenic
939538091 2:143458331-143458353 GTGTCTGCAGCTATAGTGAACGG + Intronic
939841360 2:147192087-147192109 TTGTTTGTGGCTTTAGTAACAGG - Intergenic
940314571 2:152314370-152314392 TTATCTGTGGCTATTGTAAATGG + Intergenic
940374134 2:152938310-152938332 TTTTGTGTGGCTATTGTAAATGG + Intergenic
940403924 2:153279108-153279130 GTGTGTGTGGCTATTGTGAATGG + Intergenic
940443595 2:153749587-153749609 TTATATGTGGCTATTGTAAATGG + Intergenic
940458367 2:153931095-153931117 GTGTGTGTGTCTATTGTGAATGG + Intronic
940571330 2:155438563-155438585 TTTTTTGTGGCTATTGTAAATGG + Intergenic
940628794 2:156211209-156211231 TTATTTGTGGTTATTGTGAATGG + Intergenic
941077795 2:161025845-161025867 CTTTTTGTGGCTATTGTGAATGG - Intergenic
941302626 2:163822932-163822954 TTTTGTGTGGCTATTGTAAATGG + Intergenic
941338845 2:164279918-164279940 TGGTGTGTGGCTATTGTAAATGG + Intergenic
941392458 2:164931143-164931165 TTGTGTGTGGCAATTGTGAATGG - Intronic
941587222 2:167375588-167375610 TTGTGTGTGGCTATTGTAAATGG + Intergenic
942628739 2:177933055-177933077 GTGTGTGTGGCTATTGTAAATGG - Intronic
942632484 2:177966106-177966128 TTCTGTGTGGCTATTGTGAATGG + Intronic
942746695 2:179242208-179242230 GTGTGTGTGGCTATTGTAAATGG - Intronic
942769508 2:179500030-179500052 TTATGTGTGGCTATTGTAAATGG - Intronic
942865185 2:180665095-180665117 TCTTTTGTGGCTATTGTGAATGG - Intergenic
942869041 2:180712952-180712974 TTTTTTGTGGCAATTGTGAATGG + Intergenic
943016255 2:182514070-182514092 CTTTCTGTGGCTATTGTGAATGG - Intronic
943071640 2:183147928-183147950 TGATATGTGGCTATTGTAAATGG + Intronic
943164829 2:184307977-184307999 ATTTTTGTGGCTATTGTGAATGG + Intergenic
943453173 2:188071669-188071691 ATTTGTGTGGCTATTGTGAATGG + Intergenic
943484328 2:188460395-188460417 TTATTTGTGGCTATTGTAAATGG + Intronic
943505812 2:188756083-188756105 TTATTTTTGGCTATTGTGAATGG + Intronic
943527158 2:189030611-189030633 TTGTATGTTGCTATTGTTACTGG + Intergenic
943539531 2:189195207-189195229 TTGTTTGTAGCAATTGTGAATGG - Intergenic
943589228 2:189777918-189777940 TTTAATGTGGCTATATTCAAAGG + Intronic
943873244 2:193028942-193028964 TTATTTGTGGCTATTGTAAATGG - Intergenic
944092554 2:195929114-195929136 TTGTCTGTGGCTGTTGTGAATGG - Intronic
944329061 2:198443557-198443579 TTGTCTTTGGCTATAGAAAAAGG + Intronic
944377410 2:199062853-199062875 TTATTTGTGGCTATTGTAAATGG - Intergenic
944601952 2:201312321-201312343 CTTTTTGTGTCTATAGTGAATGG - Intronic
944678902 2:202058381-202058403 TTATTTGTAGCTATTGTGAATGG - Intergenic
944922133 2:204426225-204426247 CTTTTTGTGGCTATTGTGAATGG - Intergenic
945293968 2:208152272-208152294 TTCTTTGTGGCTATTGTAAATGG - Intergenic
945430609 2:209759392-209759414 CTTTTTGTGGCTATTGTGAATGG - Intergenic
945487445 2:210413891-210413913 CTTTCTGTGGCTATTGTGAATGG + Intergenic
945494891 2:210498407-210498429 TTTTCTGTGGCTATTGTAAATGG + Intronic
945660092 2:212675225-212675247 TTCTTTGTGGCTATTGTAAATGG + Intergenic
945738561 2:213632224-213632246 TTATGTGTGGCTACAGTGAATGG + Intronic
946036846 2:216750257-216750279 TTTTTTGTGGCTATTGTAAAAGG - Intergenic
946240643 2:218352880-218352902 CTTTTTGTGGCAATAGTGAATGG + Intergenic
946903699 2:224396220-224396242 TTTCATGTGGCTGGAGTGAAGGG - Intronic
947326899 2:228989246-228989268 TTTTTTGTGGCAATTGTGAATGG - Intronic
948043592 2:234925440-234925462 CTTTATGTGGCAATTGTGAATGG + Intergenic
948507137 2:238435862-238435884 CTGTATGTGGCTGTGGTGAACGG + Exonic
1169561017 20:6800768-6800790 TTGTATGTGTCTAGAGATAACGG + Intergenic
1169678227 20:8179385-8179407 TTTTTTGTGGCTACTGTGAATGG + Intronic
1169955968 20:11103206-11103228 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1169992105 20:11514562-11514584 CTGTATGTGGTTATAGTGAGTGG + Intergenic
1170060318 20:12252270-12252292 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1170256642 20:14351491-14351513 TTATTTGTGGCTATTGTAAATGG + Intronic
1170520921 20:17184449-17184471 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1170726577 20:18933229-18933251 TTTTATGCAGCTATTGTGAAAGG + Intergenic
1170825402 20:19790388-19790410 GTGTATGTGGGTTTAGGGAAGGG + Intergenic
1170868187 20:20179269-20179291 TTTTTTGTGGCAATTGTGAATGG - Intronic
1173459707 20:43233408-43233430 TTGAATGTGGCTGTATTGCATGG - Intergenic
1173700366 20:45064699-45064721 TTTTTTGTGGCTATTGTGAATGG + Intronic
1174928722 20:54789728-54789750 GTGTGTGTGGCTATTGTGAATGG + Intergenic
1175548145 20:59793527-59793549 TTTTTTGTAGCTATTGTGAATGG + Intronic
1176899749 21:14425558-14425580 TTACATGTGGCTATTGTAAATGG - Intergenic
1177134566 21:17295779-17295801 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1177213360 21:18097465-18097487 TTATTTGTGGCTATTGTAAATGG - Intronic
1177487718 21:21780462-21780484 TTATGTGTGGCTATTGTAAATGG + Intergenic
1178004459 21:28201809-28201831 TTCTGTGTGGCTACAGTAAATGG - Intergenic
1178026218 21:28471127-28471149 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1178046600 21:28701533-28701555 GTGTGTGTGGCTATTGTGAATGG - Intergenic
1178047927 21:28716383-28716405 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1179042152 21:37813156-37813178 TTATATGTGGCTATTGTAATTGG - Intronic
1179325691 21:40341586-40341608 TTGGATGTGGATTTATTGAAAGG - Intronic
1179377969 21:40868497-40868519 TTCTTTGTGGCTATGGTAAATGG + Intergenic
1182199126 22:28552119-28552141 TTTTTTGTGGTTATCGTGAAGGG - Intronic
949166057 3:942463-942485 TTTTTTGTGGCTATTGTAAATGG - Intergenic
949798984 3:7882434-7882456 CTTTTTGTGGCTACAGTGAATGG - Intergenic
950842896 3:15984876-15984898 TTGTGTGTGGCTATTGTAAATGG + Intergenic
950927384 3:16755262-16755284 TTATTTGTGGCTATTGTAAATGG + Intergenic
950992516 3:17454825-17454847 TTATTTGTGGCTATTGTAAATGG - Intronic
951147491 3:19245693-19245715 TTCTTTGTGGCTATTGTAAATGG + Intronic
951194231 3:19805708-19805730 TTTTGTGTGGCTATTGTAAATGG - Intergenic
951518046 3:23583665-23583687 TTCTTTGTGGCTATTGTGAATGG + Intronic
951749933 3:26023554-26023576 TTTTTTGTAGCTATTGTGAAAGG + Intergenic
951766964 3:26210664-26210686 CTTTTTGTGGCTATTGTGAATGG + Intergenic
951792738 3:26504409-26504431 TTCTAAATGGCTAGAGTGAAGGG - Intergenic
951904686 3:27693187-27693209 TTATGTGTGGCTATCGTAAATGG - Intergenic
951929416 3:27947329-27947351 TTATGTGTGGCTATTGTAAATGG + Intergenic
951959923 3:28306429-28306451 GTGTGTGTGGCTATTGTAAATGG + Intronic
951979973 3:28554702-28554724 GTGTGTGTGGCAATTGTGAATGG + Intergenic
952606498 3:35153760-35153782 ATTTTTGTGGCTATTGTGAATGG + Intergenic
952626105 3:35405524-35405546 ATATATGTGGCTTTATTGAAAGG - Intergenic
952685472 3:36142955-36142977 TTTTTTGTGGCTATTGTAAATGG + Intergenic
952726185 3:36587806-36587828 TTGTTTGTGGCTATTGTGAATGG - Intergenic
953110080 3:39927075-39927097 TTGTGTGTGTCTATTGTAAATGG + Intronic
953189793 3:40674364-40674386 TTGTGCGTGGCTATTGTAAATGG - Intergenic
953333885 3:42077698-42077720 CTTTTTGTGGCTATTGTGAATGG + Intronic
953353736 3:42236071-42236093 TTATTTGTGGCTATTGTAAATGG - Intergenic
953684427 3:45065326-45065348 ATGTATCTGAGTATAGTGAAGGG - Intergenic
954077395 3:48190821-48190843 TTGTAGGGGGCTAGAGGGAAGGG + Intergenic
954509585 3:51111070-51111092 TTGTGTGTGGCAATTGTGAATGG - Intronic
954527613 3:51286207-51286229 CTTTTTGTGGCTATTGTGAATGG - Intronic
955201797 3:56858303-56858325 ATGCATGTGGATACAGTGAATGG - Intronic
955806574 3:62742016-62742038 TTTTTTGTGGCAATTGTGAATGG - Intronic
956554395 3:70502182-70502204 TTTTTTGTGGCTATTGTAAATGG - Intergenic
956852249 3:73240221-73240243 TTATGTGTGGCTATTGTAAAAGG + Intergenic
958088759 3:88848843-88848865 GTTTTTGTGGCTATTGTGAATGG + Intergenic
958463013 3:94422678-94422700 TTTTTTGTGGCTACTGTGAATGG - Intergenic
958727773 3:97926811-97926833 TTCTTTGTGTCTATTGTGAATGG - Intronic
958760520 3:98301790-98301812 TTATGTGTGGCTATTGTAAATGG - Intergenic
958817895 3:98937029-98937051 CTTTTTGTGGCTATTGTGAATGG - Intergenic
958872213 3:99573677-99573699 TTCTGTGTGGCTATTGTGAATGG - Intergenic
958875478 3:99611538-99611560 TTTTGTGTGGCAATTGTGAATGG + Intergenic
958998286 3:100931594-100931616 GTGTGTGTGGCTATTGTGAATGG - Intronic
959182237 3:102996139-102996161 TTATGTGTGGCTATTGTAAATGG - Intergenic
959241826 3:103806921-103806943 TTGTATGTGTATATGATGAAAGG + Intergenic
959257686 3:104035692-104035714 GTGTGTGTGGCTATTGTAAATGG - Intergenic
959331224 3:105007868-105007890 TTGTTTGTGGCTGTTGTAAATGG - Intergenic
959340850 3:105128748-105128770 TTTTTTGTGGCTATTGTAAATGG + Intergenic
959658741 3:108841544-108841566 TGGTTTGTGGCCATAGAGAAAGG + Intronic
959924792 3:111909028-111909050 TAGTATGTGGCTAGAGAGATGGG - Intronic
960365977 3:116772850-116772872 TCTTATGTGGCTATTTTGAAAGG + Intronic
960500504 3:118432116-118432138 ATTTTTGTGGCTATTGTGAATGG + Intergenic
960686037 3:120294726-120294748 GTGTGTGTGGCAATTGTGAATGG - Intergenic
960734202 3:120760182-120760204 CTCTATGTGGCAATTGTGAATGG + Intronic
960858637 3:122128785-122128807 TTTTTTGTGGCAATTGTGAATGG - Intergenic
961417418 3:126770093-126770115 CTTTTTGTGGCTATTGTGAATGG + Intronic
962047812 3:131779077-131779099 CTTTTTGTGGCTATTGTGAATGG - Intronic
962242242 3:133759536-133759558 TTGTATGAGTGTATGGTGAAAGG + Intronic
962305414 3:134281743-134281765 TTGTCTGTGGCTACAGGAAAAGG + Intergenic
962333388 3:134501578-134501600 TTATGTGTGGCTATTGTAAATGG + Intronic
962398238 3:135036044-135036066 ATGTATGTGGAAATAGTGAATGG - Intronic
962478195 3:135775778-135775800 CTTTCTGTGGCTATTGTGAATGG - Intergenic
962510076 3:136089857-136089879 GTGTGTGTGGCTATTGTAAATGG + Intronic
962656975 3:137557084-137557106 TTGTTTATGGCTATTGTAAATGG - Intergenic
962689064 3:137875095-137875117 TTATCTGTGGCTATTGTAAATGG - Intergenic
962768106 3:138585284-138585306 TTCTTTGTGGCTATTGTAAATGG - Intronic
962817009 3:139009821-139009843 TTATTTGTGGCTATTGTAAATGG + Intronic
962915632 3:139900820-139900842 TTTTTTGTAGCTATTGTGAATGG + Intergenic
962994233 3:140609619-140609641 CTTTTTGTGGCTATTGTGAATGG - Intergenic
963121684 3:141782021-141782043 TTTTATGTGGCTGTAATGGAAGG + Intronic
963330893 3:143914671-143914693 TTATGTGTGGCTATTGTAAATGG - Intergenic
963553205 3:146751459-146751481 TTGTCTGTGGCTATTTTAAATGG + Intergenic
963763895 3:149313337-149313359 GTGTGTGTGGCTATTGTAAATGG - Intergenic
963862058 3:150322270-150322292 TTCTTTGTGGCTATTGTGAAAGG - Intergenic
963979647 3:151523057-151523079 CTTTTTGTGGCTATTGTGAATGG - Intergenic
964134165 3:153325798-153325820 CTTTTTGTGGCTATTGTGAATGG + Intergenic
964196697 3:154073530-154073552 TTTCATGTGGCTATTGTAAATGG - Intergenic
964199214 3:154099202-154099224 TTGTATGAGGCGGTAGTTAAAGG - Intergenic
964202503 3:154133942-154133964 TTTTTTGTGGCAATTGTGAATGG + Intronic
964258482 3:154806404-154806426 TTGTTTGTAGCTATTGTAAATGG + Intergenic
964296345 3:155238415-155238437 TTGAAGGTGGCTACAGAGAAGGG - Intergenic
964459956 3:156913378-156913400 TTTTCTGTGGCTATTGTAAATGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964929871 3:162004245-162004267 TTGTGTGTGGCTATTGCAAATGG + Intergenic
965023514 3:163266812-163266834 TTGTATGTGGTGAGAGTTAAGGG + Intergenic
965344023 3:167525156-167525178 TTCTTTGTAGCTATTGTGAATGG + Intronic
965643506 3:170856128-170856150 TTGTATGTGGTCATGCTGAAGGG - Intronic
965939766 3:174165073-174165095 TTGTGTGTGTCTATTGTAAATGG + Intronic
965997035 3:174896413-174896435 TTATGTGTGGCTATTGTAAATGG - Intronic
966142693 3:176773630-176773652 TTCTATGTGGCTATTGTAAATGG - Intergenic
966145225 3:176804010-176804032 CTTTTTGTGGCTATTGTGAATGG - Intergenic
966468572 3:180261193-180261215 TTATGTGTGGCTATTGTAAATGG - Intergenic
966577286 3:181516611-181516633 TTTTTTGTGGCTATTGTTAATGG + Intergenic
966617598 3:181928845-181928867 TTTTTTGTGGCAATCGTGAATGG + Intergenic
966991783 3:185239531-185239553 TTTTTTGTGGCTATTGTAAATGG + Intronic
967502701 3:190218339-190218361 TTGTGTGTGGCAATTGTGAATGG + Intergenic
967619135 3:191610863-191610885 TTGTATGTGGCTATTTTAAATGG + Intergenic
967646126 3:191926515-191926537 TTCTTTGTGGCTATTGTAAATGG - Intergenic
968695368 4:2022804-2022826 TTGTGTGTGGCTATTGTAAACGG - Intronic
969144505 4:5109996-5110018 TTTTCTGTGGCTATTGTAAACGG - Intronic
969384106 4:6831637-6831659 CTGTGTGTGGCTATAGTTACAGG - Intronic
970296148 4:14632850-14632872 TTTTTTGTGGCAATTGTGAATGG - Intergenic
970624215 4:17859850-17859872 TCTTTTGTGGCTATTGTGAATGG - Intronic
970771630 4:19619889-19619911 TTGTGTGTGGCTATTGTAAAAGG - Intergenic
971614370 4:28768374-28768396 GTGTGTGTGGCTATAGTAAATGG - Intergenic
971665152 4:29474048-29474070 TTATGTGTGGCTATTGTAAATGG - Intergenic
971726669 4:30323168-30323190 TTATTTGTGGCTATTGTAAATGG - Intergenic
971815273 4:31478907-31478929 TTCTTTGTGGCTATTGTAAATGG + Intergenic
971891790 4:32533496-32533518 TTATGTGTGGCTATTGTAAATGG - Intergenic
972027993 4:34411526-34411548 TTAAAGGTGGCTATAGAGAATGG - Intergenic
972078977 4:35125432-35125454 CTTTTTGTGGCTATTGTGAATGG + Intergenic
972143258 4:35988083-35988105 CTTTTTGTGGCTATTGTGAATGG - Intronic
972363744 4:38353646-38353668 TTTTTTGTGGCTATTGTAAATGG - Intergenic
972419683 4:38875420-38875442 CTTTTTGTGGCTATTGTGAATGG + Intronic
972941525 4:44201049-44201071 TTCTTTGTGGCTATTGTAAATGG - Intronic
972962128 4:44466272-44466294 TTATTTGTGGCTATTGTAAATGG - Intergenic
973596213 4:52493225-52493247 TTTTCTGTGGCTATTGTAAATGG - Intergenic
973617812 4:52696820-52696842 TTTTATGTGGTGATTGTGAATGG - Intergenic
973762291 4:54129250-54129272 TTATTTGTGGCTATTGTAAATGG + Intronic
974094525 4:57348697-57348719 TTTTTTGTGGCTCTTGTGAATGG + Intergenic
974297146 4:60015284-60015306 CTTTTTGTGGCTATAGTGAATGG + Intergenic
974411650 4:61549087-61549109 CTTTTTGTGGCTATTGTGAATGG + Intronic
974460860 4:62186066-62186088 TTTTTTGTGGCTGTTGTGAATGG + Intergenic
974513487 4:62876356-62876378 TTATCTGTGGCTATTGTAAATGG - Intergenic
974704931 4:65501495-65501517 CTTTTTGTGGCTATTGTGAATGG - Intronic
974857760 4:67481184-67481206 TTATTTGTGGCTATTGTAAAAGG - Intronic
975022976 4:69513824-69513846 TTTTTTGTGGCAATTGTGAATGG + Intronic
975276702 4:72510513-72510535 TTATGTGTGGCTATTGTAAATGG - Intronic
975285886 4:72619454-72619476 TTATGTGTGGCTATTGTAAATGG - Intergenic
975510118 4:75185316-75185338 TTTTATGCAGCTATTGTGAAAGG - Intergenic
975520293 4:75293406-75293428 TTGTTTGTAGCAATTGTGAATGG + Intergenic
975649233 4:76575676-76575698 TTATTTGTGGCTATTGTAAATGG - Intronic
975752854 4:77541958-77541980 TTTTTTGTGGCTATTGTGAATGG + Intronic
975894880 4:79077187-79077209 TTTTTTGTGGCTTTTGTGAATGG + Intergenic
975917794 4:79345729-79345751 TTATTTGTGGCTATTGTAAATGG + Intergenic
975924991 4:79439416-79439438 TTATATGTAGCTATTGTAAATGG + Intergenic
976017404 4:80574203-80574225 TTGTTTGTAGCTATAGTAAATGG + Intronic
976031721 4:80763345-80763367 TTCTTTGTAGCTATTGTGAACGG - Intronic
976041457 4:80890368-80890390 TTATTTGTGGCTATTGTAAATGG - Intronic
976067281 4:81202669-81202691 TTCTGTCTGTCTATAGTGAATGG - Intronic
976109570 4:81656929-81656951 TTCTGTGTGGCTATTGTAAATGG + Intronic
976131214 4:81885986-81886008 CTGTGTGTGGCTATTGTAAATGG - Intronic
976325944 4:83771804-83771826 TCTTATGTGGCTATAATGAAAGG - Intergenic
977044867 4:92056492-92056514 TTATCTGTGGCTATTGTGAATGG - Intergenic
977287094 4:95121170-95121192 TTCTTTGTGGCTATTGTAAATGG - Intronic
977385400 4:96332963-96332985 TTTTTTGTAGCTATTGTGAATGG + Intergenic
977445684 4:97128833-97128855 ATTTTTGTGGCTATTGTGAATGG - Intergenic
977451089 4:97198950-97198972 TTTTATATGGCTTTAGAGAAGGG - Intronic
977481037 4:97576004-97576026 ATGCATGTGGCTATGGTAAATGG - Intronic
977482663 4:97598128-97598150 CTTTTTGTGGCTATTGTGAATGG - Intronic
977518628 4:98053472-98053494 TTTTATATAGCTATAGTTAATGG - Intronic
977522107 4:98097862-98097884 TTATCTGTGGCTATTGTAAATGG - Intronic
977745009 4:100536154-100536176 TTATATGTGGCTATTGTAAATGG - Intronic
977812476 4:101373184-101373206 TTATATGTGGCTATTGTAAATGG + Intergenic
977846070 4:101768846-101768868 TTCTTTGTGGCTATTGTAAATGG + Intronic
977855096 4:101880328-101880350 TTATTTGTGGCTACAGTAAATGG - Intronic
977873220 4:102118577-102118599 TTATTTGTAGCTATTGTGAATGG + Intergenic
977948362 4:102940245-102940267 TTTTTTGTGGCTATTGTGAATGG - Intronic
978047932 4:104155704-104155726 TTCTATGTGGGTATAGATAAAGG + Intergenic
978054903 4:104251591-104251613 TTATGTGTGGCTATTGTAAATGG - Intergenic
978114896 4:105007343-105007365 TTGTGTGTGTCTATTGTAAATGG - Intergenic
978117224 4:105034448-105034470 TTATATGTGGCTATTGTAAATGG - Intergenic
978117552 4:105039318-105039340 TTATGTGTGGCTATTGTAAATGG - Intergenic
978205777 4:106079553-106079575 TTGTTTGTGGCTATTGTAAATGG - Intronic
978271462 4:106894961-106894983 TTTTCTGTGGCTATTGTAAATGG - Intergenic
978286929 4:107090163-107090185 TTTTTTGTGGCTACTGTGAATGG - Intronic
978305785 4:107327353-107327375 TTTTTTGTAGCTATTGTGAAAGG + Intergenic
978519636 4:109602940-109602962 TTATCTGTGGCTATTGTAAATGG + Intronic
978674888 4:111300850-111300872 CTGTTTGTGGCAATTGTGAATGG + Intergenic
978890304 4:113818189-113818211 TTATTTGTGGCTATGGTGAATGG + Intergenic
978926846 4:114256501-114256523 TTGTATGTGGCTATTGTAAATGG - Intergenic
979052177 4:115949295-115949317 TTATATGTGGTTATTGTAAATGG + Intergenic
979208562 4:118072478-118072500 TTGTGAATGGCTATTGTGAATGG + Intronic
979301256 4:119090129-119090151 CTTTTTGTGGCTATAGTGAATGG + Intergenic
979666912 4:123321897-123321919 TTTTTTGTAGCTATTGTGAATGG - Intergenic
979996122 4:127433302-127433324 TTTTTTGTGGCTATTGTAAATGG - Intergenic
980144908 4:128970167-128970189 TTGAATTAGGCTATAGAGAATGG + Intronic
980257286 4:130398614-130398636 TTTTGTGTGGCAATTGTGAATGG + Intergenic
980347506 4:131640692-131640714 TTATGTGTGGCTATTGTAAATGG - Intergenic
980684978 4:136215770-136215792 TCTTTTGTGGCTATTGTGAATGG + Intergenic
980753750 4:137128806-137128828 ATGTGTGTGGGTAAAGTGAAGGG - Intergenic
980768641 4:137341964-137341986 ATGTATGTGTCTATAGTCAGGGG - Intergenic
980863399 4:138525907-138525929 TTCTTTGTGGCCATTGTGAATGG - Intergenic
981154655 4:141419759-141419781 TTATGTGTGGCTATTGTAAATGG + Intergenic
981329585 4:143493093-143493115 TTATGTGTGGCTATTGTAAATGG - Intergenic
981402192 4:144326519-144326541 ATTTTTGTGGCTATTGTGAATGG - Intergenic
981510425 4:145550775-145550797 TTTTCTGTGGCTATTGGGAAGGG - Intronic
981622707 4:146722052-146722074 GTGTGTGTGTCTATTGTGAATGG - Intronic
981655347 4:147106263-147106285 ATGTTTGTGGCAATTGTGAATGG - Intergenic
981976036 4:150729388-150729410 TTGTATGTTTCTATTGTAAATGG - Intronic
982050325 4:151494929-151494951 CTTTTTGTGGCTATTGTGAATGG + Intronic
982332435 4:154195946-154195968 TTTTTTGTGGCTATTGTAAATGG + Intergenic
982498363 4:156121127-156121149 TTGTTTGTGGCTATTGTAAATGG + Intergenic
982549544 4:156780604-156780626 TTGTATGTGCCTTGAGTGGAAGG + Intronic
982810256 4:159816873-159816895 TTTTTTGTGGCAATTGTGAATGG - Intergenic
982843022 4:160216671-160216693 TTGTGTGTGGCTATTCTAAATGG + Intergenic
983131633 4:164026978-164027000 TTTTTTGTGGCTATTGTAAATGG - Intronic
983334243 4:166372234-166372256 TTCTTTGTGGCAATTGTGAATGG + Intergenic
983424157 4:167560791-167560813 TTGTTTGTGGCAGTTGTGAATGG + Intergenic
983548080 4:168984298-168984320 ATTTGTGTGGCTATTGTGAATGG - Intronic
984627798 4:182027189-182027211 TTGTAAATGGCTATTGTAAATGG + Intergenic
984967660 4:185154480-185154502 TTCTTTGTGGCTATAATAAATGG - Intergenic
985186451 4:187321747-187321769 CTTTTTGTGGCTATTGTGAATGG - Intergenic
985225464 4:187755693-187755715 TTTTGTGTGGCTATTGTAAATGG + Intergenic
985324312 4:188750612-188750634 TTTTTTGTGGCAATTGTGAATGG + Intergenic
985363259 4:189198215-189198237 TTGTATCTCACTATAGGGAAGGG - Intergenic
986100710 5:4608007-4608029 TTGTGTGTGGCAATTGTGATGGG - Intergenic
986229316 5:5847494-5847516 TTTTTTGTAGCTATTGTGAATGG + Intergenic
986544217 5:8877971-8877993 TTATATGTGGCTAATGTAAATGG + Intergenic
986845889 5:11752928-11752950 CTATTTGTGGCTATTGTGAATGG + Intronic
986973662 5:13369504-13369526 TTATTTGTGGCTATTGTAAATGG - Intergenic
987166519 5:15203732-15203754 TTGAATGTGTCTATAAAGAATGG + Intergenic
987189138 5:15455778-15455800 TTGTATGTGGCTAGAGATAGTGG + Intergenic
987189186 5:15456359-15456381 TTGTGTGTGGCTATTGTAAATGG + Intergenic
987296280 5:16554783-16554805 TGGTATGTAGCCATAGTGACTGG - Intronic
987567173 5:19605475-19605497 TTCTATGTGGCTAAATTGAAAGG - Intronic
987868819 5:23584326-23584348 ATGCATGTGGCTTCAGTGAATGG + Intergenic
987900803 5:24009209-24009231 CTGTCTGTGGCTTTTGTGAATGG + Intronic
987915238 5:24204356-24204378 TTGTATTTATATATAGTGAAAGG - Intergenic
988068942 5:26262357-26262379 TTGTGTGTGGCTATTGTAATTGG + Intergenic
988259855 5:28872168-28872190 GTGTGTGTGGCTATTGTAAATGG + Intergenic
988262869 5:28911657-28911679 TTGGAGGTGGGTCTAGTGAAAGG + Intergenic
988317384 5:29647690-29647712 TTGTGTGTGGTTATTGTAAATGG + Intergenic
988353696 5:30144586-30144608 TTATGTGTGGCTATTGTAAATGG + Intergenic
988702956 5:33694045-33694067 CTTTTTGTGGCTATTGTGAATGG - Intronic
989428241 5:41321332-41321354 TTATGTGTGGCTATTGTAAATGG - Intronic
989434860 5:41399088-41399110 TTATGTGTGGCTATTGTAAATGG - Intronic
989455825 5:41642908-41642930 TTTTTTGTGGCTATAGGGAATGG - Intergenic
989459371 5:41679489-41679511 TTCTTTGTGGCTATTGTAAATGG - Intergenic
989734023 5:44680955-44680977 CTTTTTGTGGCTATTGTGAATGG - Intergenic
989758014 5:44979794-44979816 TTTTTTGTGGCTATTGTAAATGG - Intergenic
990089608 5:52025659-52025681 ATCTTTGTGGCTATTGTGAATGG - Intronic
990134225 5:52625897-52625919 TTTTTTGTGGCTATTGAGAATGG + Intergenic
990752536 5:59032842-59032864 TTATAAGTGGCGATAATGAAAGG - Intronic
990932524 5:61109206-61109228 TTGTTTGTAGCTATTGTAAATGG + Intronic
991177013 5:63700705-63700727 ATTTTTGTGGCTATTGTGAATGG - Intergenic
991226642 5:64281054-64281076 GTGTGTGTGGTTATTGTGAATGG + Intronic
991579792 5:68142678-68142700 TTGTGTGTGGCTATTGAAAATGG - Intergenic
992344258 5:75860281-75860303 TTGTGTGTGGCTATTGTAAATGG - Intergenic
992587609 5:78257411-78257433 TTGTGTGTGGCTAGTGTAAATGG - Intronic
992922495 5:81541158-81541180 TTTCCTGTGGCTATAGTAAATGG - Intronic
993266950 5:85738909-85738931 TTATTTGTGGCTATGGTAAATGG + Intergenic
993281122 5:85925675-85925697 TTTTTTGTGGCTATTGTGGATGG - Intergenic
993429693 5:87816331-87816353 CTTTTTGTGGCTATTGTGAATGG + Intergenic
993568588 5:89507156-89507178 TTGTGTGTGGCAATTGTGAATGG - Intergenic
993582739 5:89682937-89682959 TTGTGTGTGGCTATTGTAAATGG - Intergenic
993692061 5:91014123-91014145 GTGTGTGTGGCAATTGTGAATGG - Intronic
993944799 5:94105377-94105399 TCTTTTGTGGCTATTGTGAATGG - Intronic
993948748 5:94147559-94147581 TTATGTGTGGCTATTGTAAATGG - Intergenic
994021711 5:95033961-95033983 TTGTGTGTGGCTATTGTAAATGG - Intronic
994111578 5:96010851-96010873 TTCTTTGTGGCTATTGTAAATGG + Intergenic
994166194 5:96610909-96610931 ATGTGTGTGGCTATTGTAAATGG - Intronic
994227501 5:97270141-97270163 GTGTATGTGGCAGTTGTGAATGG + Intergenic
994344911 5:98672998-98673020 TTCTTTGTAGCTATTGTGAATGG - Intergenic
994381974 5:99081911-99081933 TTGTGTGTGACTGTTGTGAATGG + Intergenic
994464622 5:100111130-100111152 CTTTTTGTGGCTATTGTGAATGG + Intergenic
994596843 5:101849198-101849220 TTATATGTGGCTATTGTAGATGG + Intergenic
994598075 5:101864648-101864670 TTTTTTGTGGCAATTGTGAATGG - Intergenic
994643943 5:102446319-102446341 CTTTTTGTGGCTATCGTGAATGG + Intronic
994832543 5:104804359-104804381 TTTTTTGTGGCTATTGTCAATGG - Intergenic
995300906 5:110580905-110580927 TTCTTTGTGGCTATTGTAAATGG - Intronic
995664402 5:114524986-114525008 TTTTTTGTGGCAATTGTGAATGG - Intergenic
995685768 5:114770662-114770684 TTATTTGTGGCTATTGTAAATGG + Intergenic
995977858 5:118063382-118063404 GTGTGTGTGGCTACTGTGAATGG + Intergenic
996162679 5:120185097-120185119 TTATGTGTGGCTATTGTAAATGG - Intergenic
996195016 5:120594347-120594369 TTTTTTGTGGCTACTGTGAATGG - Intronic
996245529 5:121259422-121259444 CTTTTTGTGGCTATAATGAATGG + Intergenic
996258735 5:121439272-121439294 TTAGATGTGGCTATTGTAAATGG + Intergenic
996492923 5:124119690-124119712 GTGTGTGTGGCTATTGTAAATGG + Intergenic
996858137 5:128033019-128033041 TTTTTTGTGGCAATTGTGAATGG - Intergenic
996982460 5:129515539-129515561 TTATGTGTGGCTATTGTAAATGG + Intronic
997021842 5:130011853-130011875 CTTTTTGTGGCTATTGTGAATGG - Intronic
997040519 5:130247721-130247743 TTGTATGTAGCAGTTGTGAATGG + Intergenic
997099172 5:130949168-130949190 CTTTATGTGGCTATTGTAAATGG - Intergenic
998688269 5:144555555-144555577 CTTTATGTGGCTACTGTGAAAGG + Intergenic
998803866 5:145899149-145899171 TTTTGTGTGGCTATTGTAAATGG - Intergenic
999834785 5:155357794-155357816 TTCTTTGTGTCTATTGTGAATGG - Intergenic
1000436941 5:161223625-161223647 TTTTGTGTGGCTATTGTAAATGG - Intergenic
1000612733 5:163392670-163392692 GTGTCTGTGGCTATTGTAAATGG - Intergenic
1000698300 5:164417186-164417208 ATTTTTGTGGCTATTGTGAATGG + Intergenic
1000873692 5:166608628-166608650 TTGTATGTGGCTACTGTAAGTGG - Intergenic
1001046527 5:168376671-168376693 TTGTGTGTGGCTACTGTAAATGG - Intronic
1002967633 6:1982617-1982639 TTTTTTGTGGCAATTGTGAATGG - Intronic
1003219803 6:4149374-4149396 TTATTTGTGGCTATTGTAAATGG + Intergenic
1003410682 6:5859775-5859797 TTTTTTGTTGCTATTGTGAATGG - Intergenic
1004090820 6:12499016-12499038 TTTTTTGTGGCTATTGTGAATGG - Intergenic
1004092924 6:12523600-12523622 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1004793535 6:19055694-19055716 TTCTTTGTGGCTATTGTAAACGG - Intergenic
1006216742 6:32450127-32450149 GTGTGTGTGGCAATCGTGAATGG + Intergenic
1006558952 6:34892324-34892346 TTAGATGTGGACATAGTGAAGGG + Intronic
1007121235 6:39383903-39383925 TTTTTTGTGGCTATTGTAAATGG + Intronic
1007127292 6:39437118-39437140 TTTTTTGTGGCTATTGTAAAAGG + Intronic
1008240331 6:49102298-49102320 TACTATGTGGCTATTGTCAAAGG - Intergenic
1008304166 6:49880845-49880867 TTATGTGTGGCTATTGTAAATGG + Intergenic
1008438472 6:51504210-51504232 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1008438617 6:51506188-51506210 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1008771573 6:54985194-54985216 GTATATGTGGCAATTGTGAATGG - Intergenic
1008879443 6:56365850-56365872 CTATAAGGGGCTATAGTGAAAGG - Intronic
1008948079 6:57121622-57121644 TTTTGTGTGGCTATTGTAAATGG - Intronic
1009497512 6:64369779-64369801 CTTTTTGTGGCTATTGTGAATGG + Intronic
1009646471 6:66409404-66409426 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1009893406 6:69717107-69717129 CAGTTTGTGGCTATTGTGAATGG + Intronic
1009997431 6:70911897-70911919 TTTTGTGTGGCTATTATGAATGG + Intronic
1010303814 6:74292548-74292570 TTATTTGTGGCTATTGTAAAGGG + Intergenic
1010363290 6:75019819-75019841 TTATTTGTGGCTATTGTAAATGG + Intergenic
1010466255 6:76170032-76170054 ATTTTTGTGGCTATTGTGAATGG - Intergenic
1010473252 6:76255207-76255229 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1010481890 6:76365201-76365223 TTATGTGTGGCTATTGTAAATGG + Intergenic
1010557612 6:77303572-77303594 TTATTTGTGGCTATTGTAAATGG + Intergenic
1010677902 6:78765986-78766008 TTATTTGTGGCTATTGTAAATGG - Intergenic
1010796394 6:80121612-80121634 TTGTTTGTAGCAATTGTGAATGG + Intronic
1011092898 6:83626606-83626628 TTTTTTGTGGCTATTGTAAATGG + Intronic
1011309135 6:85962414-85962436 TTGTATGTGGCGAGAGATAAGGG + Intergenic
1011800944 6:91015618-91015640 GTGTATGTGTCTTTAGGGAAGGG + Intergenic
1011888023 6:92121946-92121968 TATTATGTGGCCATAGAGAAGGG + Intergenic
1011891414 6:92165609-92165631 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1011972426 6:93244154-93244176 TTGTATCTGGCTATTAAGAAAGG - Intronic
1012019611 6:93901954-93901976 TGGTATGTGCTTATAGTGATTGG + Intergenic
1012070731 6:94612117-94612139 TTGTGAGTGGCTATTGTAAATGG - Intergenic
1012201745 6:96415152-96415174 TTTTCTGTGGCTATTGTGAATGG - Intergenic
1012287993 6:97416811-97416833 TTATTTGTGGCTATTGTCAATGG + Intergenic
1012355062 6:98304035-98304057 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1013393353 6:109709710-109709732 TTTTTTGTGGCAATTGTGAATGG + Intronic
1013562773 6:111322568-111322590 TTGTATATGGCGATACTGACAGG - Exonic
1013708633 6:112871193-112871215 TTCTTTGTGGCAATTGTGAATGG - Intergenic
1013727508 6:113117477-113117499 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1013991701 6:116261367-116261389 TTTTGTGTGGCTATTGTGAATGG + Intronic
1014133413 6:117861018-117861040 TTTTCTGTGGCAATTGTGAATGG - Intergenic
1014193952 6:118530745-118530767 TTTTTTGTGGCTATTGTCAATGG - Intronic
1014373993 6:120649450-120649472 TTGTTTGTGGCTATTGTAAGTGG - Intergenic
1014379193 6:120717753-120717775 TTATGTGTGGCTATTGTAAAAGG - Intergenic
1014390934 6:120863250-120863272 TTATGTGTGGCTATTGTAAATGG - Intergenic
1014413578 6:121155257-121155279 GTGTGTGTGGCTATAGCAAATGG + Intronic
1014525749 6:122499940-122499962 TTTTATGTGGCTATTGTAAATGG - Intronic
1014583414 6:123166571-123166593 TTATGTATGGCTATTGTGAATGG - Intergenic
1014819363 6:125969737-125969759 GTGTGTGTGGCTATTGTAAATGG + Intronic
1014841197 6:126222575-126222597 TTTTTTTTGGCTATCGTGAATGG + Intergenic
1014911076 6:127093649-127093671 TTCTCTGTGGCTATAGTAACTGG - Intergenic
1014928846 6:127308851-127308873 TTATGTGTGGCTATTGTAAATGG - Intronic
1015039072 6:128694452-128694474 TTGGAAGTGGCTATTGTGTAGGG + Intergenic
1015931741 6:138367447-138367469 TTCTTTGTAGCAATAGTGAATGG - Intergenic
1015959859 6:138636655-138636677 TTCAGTGTGGCTATTGTGAATGG - Intronic
1016088812 6:139949947-139949969 ATTTTTGTGGCTATTGTGAATGG - Intergenic
1016125755 6:140400633-140400655 TTCAAAGTGGCTATAATGAAAGG + Intergenic
1016398265 6:143650081-143650103 TTTTTTGTGGCCATTGTGAATGG - Intronic
1016567929 6:145478171-145478193 TTATGTGTGGCTATTGTAAATGG - Intergenic
1016612355 6:146005344-146005366 TTATTTGTGGCTATTGTAAATGG - Intergenic
1016633905 6:146265818-146265840 TTGTATGTGGCTTTACTTATGGG + Intronic
1016707332 6:147125292-147125314 TTATGTGTGGCTATTGTGAATGG + Intergenic
1016762637 6:147755308-147755330 TTATGCGTGGCTATAGTAAATGG + Intergenic
1017277872 6:152591136-152591158 TTCTTTGTGGCTATTGTGAGTGG + Intronic
1017357947 6:153532092-153532114 TTGTATGTGTCTGCTGTGAATGG + Intergenic
1017365935 6:153637663-153637685 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1018125086 6:160674719-160674741 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1018317048 6:162567515-162567537 TTATGTGTGGCTATTGTAAATGG - Intronic
1018355856 6:163015598-163015620 CTGTATGTGGCTATTGTAAATGG + Intronic
1018361333 6:163072849-163072871 TTATCTGTGGCTATTGTAAATGG - Intronic
1018661886 6:166095625-166095647 GTGTGTGTGGCAATTGTGAATGG + Intergenic
1018692506 6:166359600-166359622 ATGTGTGTGGCTATTGTAAATGG + Intergenic
1019382786 7:733857-733879 TTGTTTGTAGCTATTGTAAATGG + Intronic
1019853220 7:3580033-3580055 ATGTTTGTGGCTATTGAGAATGG - Intronic
1020414320 7:7928731-7928753 TTGAAGGTGGGTGTAGTGAAAGG - Intronic
1020488315 7:8746888-8746910 ATGTTTGTGGTTATATTGAAGGG + Intronic
1020490323 7:8774667-8774689 CTGTGTGTGGCTATTGTAAATGG + Intergenic
1020519189 7:9165125-9165147 CTCTTTGTGGCTATTGTGAATGG + Intergenic
1020543275 7:9489803-9489825 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1020646753 7:10823949-10823971 TTTTTTGTGGCTATCGTAAATGG - Intergenic
1020702680 7:11502698-11502720 GTGTGTGTGGCAATTGTGAATGG - Intronic
1020735620 7:11945765-11945787 ATTTTTGTGGCTATTGTGAATGG + Intergenic
1021055774 7:16044212-16044234 TTGTATTTCGCTATAGAAAATGG - Intergenic
1021259298 7:18433658-18433680 GTGTGTGTGTCTATTGTGAATGG - Intronic
1021325334 7:19259358-19259380 TTGTTTGTGGCCATTGTAAATGG - Intergenic
1021375221 7:19898575-19898597 TTTTATGTGTCTATAGCTAAAGG + Intergenic
1021641358 7:22740421-22740443 TTATATGTGACTATCGTAAATGG - Intergenic
1022061559 7:26801748-26801770 TTATGTGTGGCTATTGTAAATGG - Intronic
1022153723 7:27637829-27637851 CTTTTTGTGGCTATTGTGAATGG - Intronic
1023075518 7:36478444-36478466 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1023325210 7:39047457-39047479 TTTTATGTTACTATTGTGAATGG + Intronic
1023517233 7:41013636-41013658 GTGCATGTGGCTGTAGTGAATGG + Intergenic
1023584769 7:41717739-41717761 TGGAATGTGGCTATTGTGACTGG + Intergenic
1024028920 7:45439532-45439554 TTATATGTGGCTATTGTAAATGG - Intergenic
1024115197 7:46186276-46186298 TTGCATGTGGCTATAAGGAGAGG + Intergenic
1024351512 7:48370142-48370164 TTTTTTGTAGCTATTGTGAAAGG + Intronic
1024353021 7:48386704-48386726 TTGTATATGGCAATAAGGAAGGG - Intronic
1024660823 7:51492448-51492470 TTATGTGTGGCTATTGTAAATGG + Intergenic
1024733892 7:52282389-52282411 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1024758329 7:52563240-52563262 TTGCATGTTGATAAAGTGAAAGG + Intergenic
1024892216 7:54216980-54217002 TTATGTGTGGCTATTGTAAATGG - Intergenic
1025072188 7:55909782-55909804 TTTTGTGTGGCTATTGTAAATGG + Intronic
1026399043 7:69990296-69990318 TTGTATGTGCCCAGAGGGAAGGG + Intronic
1027303617 7:76868317-76868339 CTGTAAGTGGCAATAGAGAAGGG - Intergenic
1027554313 7:79644206-79644228 TTTTAGGTGGCTACTGTGAATGG + Intergenic
1027949511 7:84796486-84796508 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1028030952 7:85911849-85911871 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1028183838 7:87757427-87757449 TTATTTGTGGCTATTGTAAATGG - Intronic
1028225907 7:88252250-88252272 TTATTTGTGGCTATTGTAAATGG + Intergenic
1028255760 7:88595635-88595657 TTTTGTGTGGCTATTGTAAATGG - Intergenic
1028293002 7:89091706-89091728 TTGTAGGTGGTTACAGTGAGAGG - Intronic
1028353107 7:89873802-89873824 TTGTGTGTGGCTATTATAAATGG + Intergenic
1028365591 7:90026712-90026734 TTATTTGTGGCTATTGTAAATGG - Intergenic
1028709886 7:93894715-93894737 TTGTCTGTGGCTAAAGACAAAGG + Intronic
1028713214 7:93934747-93934769 TCATATTTTGCTATAGTGAAAGG + Intergenic
1029314918 7:99702994-99703016 TTATTTGTGGCTATTGTAAATGG + Intronic
1029320596 7:99755884-99755906 TTATTTGTGGCTATTGTAAATGG + Intergenic
1029586399 7:101474635-101474657 GTGTCTGGGGCTATGGTGAAAGG + Intronic
1029825686 7:103191363-103191385 TTATATGTGGCTACTGTAAATGG - Intergenic
1029867260 7:103647446-103647468 TTGTTTGTAGCTATTGTAAATGG - Intronic
1029907815 7:104109459-104109481 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1030242269 7:107341267-107341289 TTGTGTGTGGCTATTGTAAATGG - Intronic
1030531232 7:110713689-110713711 TGGTGTGTGGCTATTGTAAATGG + Intronic
1030614129 7:111720041-111720063 TTTTTTGTGGCTATTGTGAGTGG + Intergenic
1031242457 7:119264308-119264330 TTGTTTTTGGCTATTGTAAATGG + Intergenic
1031248354 7:119347380-119347402 ATTTATGTGGCTATTATGAATGG + Intergenic
1031260360 7:119510615-119510637 TTATCTGTGGCTATTGTAAACGG - Intergenic
1031268840 7:119618559-119618581 TCTTTTGTGGCTATTGTGAATGG - Intergenic
1031287428 7:119887293-119887315 TTATGTGTGGCTATTGTAAACGG + Intergenic
1031294782 7:119987555-119987577 TTTTTTGTGGCTATTGTGAATGG - Intergenic
1031434886 7:121721306-121721328 GTGTGTGTGGCTATTGTAAATGG + Intergenic
1031724350 7:125218681-125218703 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1031748176 7:125532886-125532908 TTGTTTGTAGCTGTAGAGAAGGG - Intergenic
1031846514 7:126811613-126811635 TTTTCTGTGGCTATAATAAATGG + Intronic
1031906111 7:127461564-127461586 TTATGTGTGGCTATTGTAAATGG - Intergenic
1032231353 7:130077500-130077522 TTGTTTGTTGCTATTGTAAATGG + Intronic
1032329030 7:130960225-130960247 TTGAATATGGCTACAGTTAATGG - Intergenic
1032361543 7:131260371-131260393 CTTTTTGTGGCTATTGTGAATGG - Intronic
1032647663 7:133843417-133843439 CTTTTTGTGGCTATTGTGAATGG + Intronic
1033270280 7:139925394-139925416 TTATTTGTGGCTATTGTAAATGG + Intronic
1033574166 7:142664065-142664087 TTGTGTGTGGCAATTATGAATGG + Intergenic
1033836310 7:145316426-145316448 CTGTTTGTGGCAATAGTGAATGG - Intergenic
1034019227 7:147623498-147623520 TTATCTGTGGCTATTGTAAATGG - Intronic
1034216465 7:149410586-149410608 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1034581277 7:152044541-152044563 TTATTTGTGGCTATTGTAAATGG + Intronic
1035084148 7:156242165-156242187 TTATTTGTGGCTATTGTAAATGG + Intergenic
1037255852 8:16952569-16952591 TTATTTGTGGCTATTGTAAATGG - Intergenic
1037921868 8:22812394-22812416 TTGTATGTGGCCACCCTGAAGGG - Intronic
1038330651 8:26605724-26605746 TTTTATGTTGCTATTGTGTATGG - Intronic
1038519938 8:28222608-28222630 TTGTCTGTGACTATGGTGAATGG + Intergenic
1038990645 8:32863992-32864014 GTTTTTGTGGCTATTGTGAATGG - Intergenic
1039007621 8:33057930-33057952 TTCTTTGTGGCTATTGTAAATGG + Intergenic
1039098191 8:33910025-33910047 TTTTTTGTAGCTATAGTAAATGG - Intergenic
1039264825 8:35813410-35813432 GTGTGTGTGGCAATTGTGAATGG - Intergenic
1039383627 8:37110193-37110215 CTGTTTGTGGCAATTGTGAATGG - Intergenic
1039646855 8:39294774-39294796 TTTTTTGTAGCTATAGTAAATGG + Intergenic
1039647104 8:39298771-39298793 TTATTTGTGGCTATTGTAAATGG + Intergenic
1039680831 8:39734181-39734203 TTGTATGTGGCCTTAGGTAAGGG - Intergenic
1040961762 8:53041648-53041670 TTTTGTGTGGCTATTGTGAATGG + Intergenic
1041728517 8:61041577-61041599 TTGTGTGTGGCTATTGTAAGTGG + Intergenic
1041749828 8:61248538-61248560 GTGTGTGTGGCAATTGTGAATGG + Intronic
1041832357 8:62168917-62168939 TTTTTTGCAGCTATAGTGAAAGG - Intergenic
1042032826 8:64495421-64495443 TTATTTGTGGCTATTGTAAATGG - Intergenic
1042082131 8:65066083-65066105 TTATTTGTGGCTATTGTAAATGG + Intergenic
1042110087 8:65372102-65372124 TTTTATGTGGCTATTGTAAATGG - Intergenic
1042138242 8:65652612-65652634 TTATTTGTGGCTATTGTAAATGG + Intronic
1042401145 8:68348716-68348738 TTTTTTGTGGCAATTGTGAATGG + Intronic
1042980755 8:74525004-74525026 TTATTTGTGGCTATTGTGAATGG - Intergenic
1043133883 8:76497002-76497024 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1043329795 8:79101508-79101530 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1043343999 8:79277619-79277641 TTCTCTGTGGCTATTGTAAATGG - Intergenic
1043819621 8:84846387-84846409 TTGTTTGTGGCTATTGTGAATGG + Intronic
1043836035 8:85047389-85047411 TTCTTTGTGGCTATTGTGAATGG + Intergenic
1043845466 8:85158171-85158193 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1044314713 8:90736449-90736471 CTTTATGAGGCTATTGTGAATGG - Intronic
1044316995 8:90761429-90761451 TTATGTGTGGCTATTGTAAATGG + Intronic
1045410983 8:101918727-101918749 GTGTGTGTGGCTATTGTAAATGG - Intronic
1045592765 8:103616763-103616785 TTTTGTGTGGCAATTGTGAATGG - Intronic
1045786131 8:105922909-105922931 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1045817059 8:106289404-106289426 TTCTTTGTGGCTATTGTAAATGG - Intronic
1046199722 8:110909086-110909108 TTTTTTGTGGCTATAGTAAACGG - Intergenic
1046213451 8:111110981-111111003 TTCAATGTGGCAATATTGAAGGG + Intergenic
1046889525 8:119406804-119406826 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1047341831 8:123988574-123988596 TTATTTGTGGCTATTGTAAATGG + Intronic
1047580526 8:126209849-126209871 TTTTGTATGGCTATTGTGAATGG + Intergenic
1047630577 8:126702512-126702534 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1048086154 8:131182354-131182376 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1048241329 8:132744425-132744447 TTTTTTGTGGCTATTGTAAATGG - Intronic
1050309982 9:4342845-4342867 GTGTGTGTGGCTATTGTGAATGG + Intronic
1050481621 9:6093791-6093813 TTTTGTGTGGTTATGGTGAACGG + Intergenic
1050723923 9:8624428-8624450 GTATACGTGGCTATGGTGAAGGG - Intronic
1050874094 9:10613367-10613389 TCCTCTGTGGCTATAGTGATGGG - Intergenic
1050928185 9:11292477-11292499 TTATGTGTGGCTATTGTGAATGG + Intergenic
1051032032 9:12692816-12692838 TTATGTGTGGCTATTGTAAATGG + Intronic
1051047588 9:12893617-12893639 TTATTTGTGGCTATTGTAAATGG - Intergenic
1051190941 9:14512086-14512108 ATGTATGTTACTATTGTGAATGG + Intergenic
1051442849 9:17105011-17105033 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1051456192 9:17261424-17261446 TTTTTTGTGGCTATTGTAAATGG + Intronic
1051494493 9:17704182-17704204 CTTTTTGTGGCTATTGTGAATGG - Intronic
1051524320 9:18025996-18026018 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1051923365 9:22294097-22294119 TTATGTGTGGCTATTGTAAATGG + Intergenic
1051968475 9:22859093-22859115 TTTTCTGTGGTTATTGTGAATGG - Intergenic
1052258369 9:26485921-26485943 TTATGTGTGGCTATTGTAAATGG + Intergenic
1052377802 9:27737497-27737519 GTGTGTGTGGCAATTGTGAATGG + Intergenic
1052420682 9:28240024-28240046 TTATTTGTGGCTATTGTAAATGG - Intronic
1052482432 9:29048209-29048231 TTATGTGTGGCTATTGTAAATGG - Intergenic
1052539200 9:29786141-29786163 TTATGTGTGGCTATTGTAAATGG - Intergenic
1052583485 9:30392632-30392654 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1052651039 9:31301493-31301515 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1052733193 9:32313403-32313425 TTATTTGTGGCTATTGTAAATGG - Intergenic
1052761636 9:32598107-32598129 TTATATGTGACTATTGTAAATGG - Intergenic
1052886620 9:33655508-33655530 TTGTGTGTGGCAATTATGAATGG + Intergenic
1052940706 9:34129995-34130017 TTGTATGTTTCTATAGAGACAGG - Intergenic
1053605613 9:39655579-39655601 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1053863533 9:42412209-42412231 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1054247930 9:62686836-62686858 TTGTGTGTGGCTATTGTAAATGG - Intergenic
1054562044 9:66721361-66721383 TTGTGTGTGGCTATTGTAAATGG - Intergenic
1054854309 9:69881909-69881931 TTATTTGTGGCTATCGTAAATGG + Intronic
1054884526 9:70181604-70181626 TTCTTTGTAGCTATTGTGAATGG + Intronic
1055217677 9:73886309-73886331 CTTTATGTGGCAATTGTGAATGG + Intergenic
1055304785 9:74918162-74918184 TTTGATTTGGCTATTGTGAATGG - Intergenic
1055367538 9:75561172-75561194 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1055745096 9:79435167-79435189 TTATTTGTGGCTATAGTAAATGG - Intergenic
1055908800 9:81324011-81324033 ATTTATGTAGCTATAGTAAATGG + Intergenic
1056107183 9:83358708-83358730 TTATTTGTAGCTATTGTGAAAGG + Intronic
1056181483 9:84087526-84087548 GTGTATGTGGCAATTGTGAATGG + Intergenic
1056517112 9:87364304-87364326 TTATGTGTGGCTATTGTAAATGG - Intergenic
1056697115 9:88868456-88868478 TTATTTGTGGCTATTGTAAATGG - Intergenic
1057628322 9:96698901-96698923 TTGTATATGGTTTTAGGGAAAGG - Intergenic
1058144206 9:101393682-101393704 GTGTGTGTGGCTATTGTTAATGG - Intronic
1058384959 9:104424934-104424956 TTATTTGTGGCTATAGTAAATGG + Intergenic
1058392287 9:104509438-104509460 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1058441423 9:105011628-105011650 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1058571835 9:106354765-106354787 TTTTTTGTGGCTCTTGTGAATGG + Intergenic
1059510742 9:114843595-114843617 TCTTTTGTGGCTATTGTGAATGG - Intergenic
1059622705 9:116025621-116025643 TTTTCTGTGGCTATTGTGAATGG + Intergenic
1059778655 9:117503230-117503252 TTGTTTGTGGCTATTGTGAATGG + Intergenic
1059807539 9:117819306-117819328 TTCTTTGTGGCTATTGTAAATGG + Intergenic
1060117663 9:120956312-120956334 GTGTGTGTGGCTATTGTGAATGG - Intronic
1060122767 9:121010376-121010398 TTATTTGTGGCTATTGTAAATGG - Intronic
1060319057 9:122538380-122538402 GTGTTTGTGGCTATTGTAAATGG + Intergenic
1203441497 Un_GL000219v1:12942-12964 TTTTATGTAGCTATTGTAAAAGG - Intergenic
1203512306 Un_KI270741v1:131850-131872 TTTTATGTAGCTATTGTAAAAGG - Intergenic
1186018265 X:5224353-5224375 CTTTCTGTGGCTATTGTGAATGG - Intergenic
1186296781 X:8157585-8157607 ATGTATGTGTCTATACTGAAGGG - Intergenic
1186355601 X:8786367-8786389 ATGTATCTGTCTATACTGAAGGG + Intergenic
1186377343 X:9018604-9018626 ATGTATCTGTCTATACTGAAGGG + Intergenic
1186686189 X:11927133-11927155 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1186962841 X:14756144-14756166 TTGTATGTGGCTGTAGGTAAGGG - Intergenic
1186983640 X:14986181-14986203 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1187115158 X:16341935-16341957 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1187615182 X:20985830-20985852 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1187639286 X:21270520-21270542 TTGTTTGTAGCTATTGTAAATGG - Intergenic
1187810421 X:23170625-23170647 GTGCATATGGCTATTGTGAAAGG + Intergenic
1187845844 X:23536243-23536265 TTGTATGTGTCTATTGTGAATGG - Intergenic
1188020341 X:25150286-25150308 TTATATGTGGCTATTGTAGATGG + Intergenic
1188035251 X:25310513-25310535 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1188123880 X:26344035-26344057 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1188139322 X:26528938-26528960 GTGTGTGTGGCAATTGTGAAGGG - Intergenic
1188148846 X:26647766-26647788 TTTTTTGTGGTTATTGTGAATGG + Intergenic
1188298002 X:28473434-28473456 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1188341693 X:29010005-29010027 TTATGTGTAGCTATAGTAAATGG + Intronic
1188413986 X:29909529-29909551 TTTTTTGTGGCTATTGTGAATGG - Intronic
1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG + Intronic
1188738458 X:33747148-33747170 TCTTTTGTGGCTATTGTGAATGG + Intergenic
1188741721 X:33791616-33791638 TTATGTGTGGCTATTGTAAATGG + Intergenic
1188745371 X:33834649-33834671 TTATGTGTGGCTATTGTAAATGG + Intergenic
1188775555 X:34214173-34214195 ATTTTTGTGGCTATTGTGAATGG - Intergenic
1188864962 X:35303562-35303584 TGGTGTGTGGCTATTGTGAATGG - Intergenic
1188929861 X:36094621-36094643 TTATTTGTGGCTATTGTAAATGG + Intronic
1189584036 X:42439079-42439101 TTTTCTGTGGCTATTGTGAATGG - Intergenic
1189653481 X:43215473-43215495 TTTTTTGTGGCTATTGTGAATGG - Intergenic
1189769642 X:44411728-44411750 TTATTTGTGGCTATTGTAAATGG + Intergenic
1189881143 X:45493710-45493732 TTATTTGTGGCTATTGTCAATGG + Intergenic
1189885272 X:45537542-45537564 TTATTTGTGGCTATTGTAAATGG - Intergenic
1190006178 X:46740651-46740673 TTGTTTGTGGCTATTGTAAGTGG - Intronic
1190374097 X:49772205-49772227 TTATTTGTGGCTATGGTGAATGG + Intergenic
1190615722 X:52228527-52228549 TTATGTGTGGCTATTGTAAATGG - Intergenic
1190945360 X:55087782-55087804 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1190961047 X:55248070-55248092 TTATTTGTGGCTATTGTAAATGG - Intronic
1190989709 X:55534276-55534298 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1191001747 X:55667106-55667128 TTTTTTGTGGCTATTGTGAATGG - Intergenic
1191002553 X:55676063-55676085 TTTTATGTGGCTATTGTAAATGG + Intergenic
1191061709 X:56304920-56304942 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1191095317 X:56667376-56667398 TTGTGTGTGACTATTGTTAAAGG - Intergenic
1191140371 X:57110072-57110094 TATTTTGTGGCTATTGTGAAAGG - Intergenic
1191171981 X:57457684-57457706 TTTTTTGTGGCTATTGTAAATGG - Intronic
1191180426 X:57557279-57557301 TTGTTGTTGGCTATTGTGAATGG - Intergenic
1191219434 X:57971550-57971572 TTGTGTGTGGGTATTATGAATGG + Intergenic
1191651726 X:63545716-63545738 GTGTGTGTGGCTATTGTGAATGG - Intergenic
1191801299 X:65083500-65083522 TTATGTGTGGCTATTGTAAATGG - Intergenic
1191830484 X:65409716-65409738 TTATTTGTGGCTATTGTAAATGG - Intronic
1191906531 X:66097965-66097987 TTGTATGAGGCTAAGGTGTAGGG - Intergenic
1192074106 X:67973138-67973160 TTGTGTATGGCTATTGTAAATGG - Intergenic
1192130916 X:68549054-68549076 TTGTATATGTATATAGTCAATGG - Intergenic
1192300340 X:69894656-69894678 TTTTTTGTGGCTATTGTGAGTGG + Intronic
1192530539 X:71879450-71879472 TTATTCGTGGCTATTGTGAATGG - Intergenic
1192631435 X:72780794-72780816 ATGTATGTGGTTATAGTCATGGG - Intronic
1192633604 X:72796477-72796499 TTTTTTGTGGCTATTGTAAATGG + Intronic
1192648106 X:72924324-72924346 TTTTTTGTGGCTATTGTAAATGG - Intronic
1192650274 X:72940007-72940029 ATGTATGTGGTTATAGTCATGGG + Intronic
1192655886 X:72994057-72994079 TTATGTGTGGCTATTGTAAATGG - Intergenic
1192671394 X:73146038-73146060 TTATTTGTGGCTATTGTAAATGG + Intergenic
1192740394 X:73886740-73886762 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1192753633 X:74021834-74021856 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1192812972 X:74564200-74564222 TTATATGTGGCAATTGTCAATGG - Intergenic
1192854131 X:74990016-74990038 TTATGTGTGGCTATTGTAAATGG - Intergenic
1192892306 X:75403620-75403642 TTTTTTGTGGCAATTGTGAATGG - Intronic
1192990207 X:76444549-76444571 TTATTTGTGGCTATTGTAAATGG + Intergenic
1193064193 X:77240603-77240625 TTATGTGTGGCTATTGTAAATGG - Intergenic
1193175943 X:78393062-78393084 TTGTGTGTGGCTATTGTAAAAGG - Intergenic
1193236979 X:79119169-79119191 GTGTGTGTGTCTATAGTGAATGG + Intergenic
1193274121 X:79565939-79565961 TTTTTTGTGGCAATTGTGAATGG + Intergenic
1193277772 X:79609602-79609624 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1193291071 X:79773276-79773298 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1193337011 X:80302077-80302099 TTCTGTGTGGCTATTGTAAATGG + Intergenic
1193358093 X:80546372-80546394 TTCTGTATGGCTATTGTGAATGG - Intergenic
1193396920 X:80995678-80995700 TTATTTGTGGCTATTGTAAATGG - Intergenic
1193421499 X:81288676-81288698 TTATTTGTGGCTATTGTAAATGG - Intronic
1193425132 X:81332982-81333004 TTTATTGTGGCTATTGTGAATGG + Intergenic
1193487026 X:82098119-82098141 ATGTTTGTGGCTATTGTAAACGG + Intergenic
1193551818 X:82902890-82902912 TTTTTTGTGGCTATTGTGAATGG - Intergenic
1193554992 X:82942620-82942642 GTGTGTGTGGCTACTGTGAATGG + Intergenic
1193567748 X:83099150-83099172 TTTTTGGTGGCTATTGTGAAGGG - Intergenic
1193612286 X:83647150-83647172 TTTCATGTGGCTATTGTAAATGG + Intergenic
1193662331 X:84272593-84272615 TTGTATGTGGTATTAGTAAAGGG - Intergenic
1193687609 X:84597249-84597271 TTTTTTGTTGCTATTGTGAAGGG - Intergenic
1193691583 X:84651913-84651935 TTACATGTGGCTATTGTAAATGG + Intergenic
1193697500 X:84726506-84726528 TTATTTGTGGCTATTGTAAATGG + Intergenic
1193752382 X:85361994-85362016 GTGTGTGTGGCAATTGTGAAAGG + Intronic
1193756300 X:85412987-85413009 TTCTTTGTAGCTATTGTGAATGG + Intergenic
1193784540 X:85743725-85743747 TTGTGTGTGGCTATTGTGAGTGG - Intergenic
1193854935 X:86588612-86588634 TTGTTTGTGGTTATTGTGAATGG + Intronic
1193933653 X:87588044-87588066 TTATGTGTGGCTATTGTAAATGG - Intronic
1193956733 X:87873106-87873128 TTATTTGTGGCTATTGTAAATGG - Intergenic
1193970741 X:88048731-88048753 TTGTATATGGCTAAAGGTAAGGG - Intergenic
1193985123 X:88231486-88231508 TTATATGTGGCTACTGTAAATGG - Intergenic
1193985508 X:88236735-88236757 TTTTCTGTGGCAATTGTGAATGG + Intergenic
1194029471 X:88794057-88794079 TTCTATGTGGCTATTGTGAGTGG - Intergenic
1194116442 X:89904675-89904697 TTGTGTGTGGCAACTGTGAACGG - Intergenic
1194137568 X:90165255-90165277 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1194171348 X:90587307-90587329 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1194226181 X:91261298-91261320 TTTTATGTGGCTATCGTAAATGG + Intergenic
1194246667 X:91520730-91520752 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1194251519 X:91581306-91581328 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1194287810 X:92032233-92032255 TTATTTGTGGCTATTGTAAATGG + Intronic
1194306271 X:92253689-92253711 TTATGTGTGGCTATTGTAAATGG + Intronic
1194352497 X:92838221-92838243 TTATGTGTGGCTATTGTAAATGG - Intergenic
1194427814 X:93761937-93761959 TTTTCTGTGACTGTAGTGAAAGG + Intergenic
1194431867 X:93817907-93817929 TTATTTGTGGCTATTGTAAATGG - Intergenic
1194439564 X:93914860-93914882 TTCTTTGTGGCTATTGTAAATGG - Intergenic
1194521843 X:94929263-94929285 TTATTTGTGGCTATTGTAAATGG + Intergenic
1194606049 X:95979732-95979754 TTATATGTGGCCATGGTAAATGG - Intergenic
1194753535 X:97710664-97710686 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1194811519 X:98392915-98392937 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1194929724 X:99871804-99871826 TTATTTGTGGCTATTGTAAATGG - Intergenic
1194965372 X:100282382-100282404 TTATGTGTGGCTATACTAAATGG + Intergenic
1194982730 X:100457018-100457040 TTTTTTGTTGCTATTGTGAATGG - Intergenic
1195024132 X:100858681-100858703 TTTTTTGTGGCTATTGTGAATGG + Intronic
1195224192 X:102775480-102775502 TCGTTTGTGGCTATTGTAAATGG + Intergenic
1195500307 X:105590125-105590147 TCTTTTGTGGCTATTGTGAATGG + Intronic
1195558359 X:106253583-106253605 TTATGTGTGGCTATTGTAAATGG + Intergenic
1195971625 X:110479699-110479721 CTGTTTGTCGCTATTGTGAATGG + Intergenic
1196044144 X:111238974-111238996 GTGTATGTGGCTATTGTAAATGG - Intergenic
1196067868 X:111485358-111485380 TTATGTGTGGCTATTGTAAATGG + Intergenic
1196154438 X:112412094-112412116 TTGTTTGTAGCTATTGTAAATGG - Intergenic
1196316003 X:114224450-114224472 TTATGTGTGGCTATTGTAAATGG - Intergenic
1196547698 X:116982823-116982845 TTGTGTGTAGCTATTGTAAATGG - Intergenic
1196599613 X:117586383-117586405 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1196933106 X:120701116-120701138 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1196984016 X:121248263-121248285 TTATGTGTGGCTATTGTAAATGG + Intergenic
1197088248 X:122505335-122505357 GTGTATATGGCTATTGTGAATGG + Intergenic
1197132237 X:123019166-123019188 CTTTTTGTGGCTATTGTGAATGG + Intergenic
1197190265 X:123639492-123639514 TTTTTTGTGGCTATTGTAAATGG + Intronic
1197308021 X:124867876-124867898 TTCTGTGTGGCTATTGTAAATGG - Intronic
1197468800 X:126840830-126840852 TTCTGTGTGGCTATTGTAAATGG - Intergenic
1197581578 X:128290358-128290380 TTCTGTGTAGCTATAGTAAATGG - Intergenic
1197625447 X:128796965-128796987 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1197642504 X:128982427-128982449 TTTTTTGTGGCAATTGTGAATGG - Intergenic
1198169090 X:134087856-134087878 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1198269676 X:135044111-135044133 TTTTTTGTGGCTATCGTGAATGG + Intergenic
1198548040 X:137714362-137714384 TTTTATGTAGCTATTGTAAATGG + Intergenic
1198584192 X:138101496-138101518 TTGTTTGTAGCTATTGTTAATGG - Intergenic
1198759201 X:140013329-140013351 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1198770145 X:140122089-140122111 TTATTTGTGGCTATTGTAAATGG + Intergenic
1198779538 X:140220243-140220265 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1198781395 X:140240024-140240046 TTATGTGTGGCTATTGTAAATGG + Intergenic
1198787846 X:140310503-140310525 TTTTCTGTGGCTATTGTAAATGG - Intergenic
1198925310 X:141785121-141785143 TTATTTGTGGCTATTGTAAATGG + Intergenic
1198938558 X:141926804-141926826 TTATGTGTGGCTATTGTAAATGG + Intergenic
1199015655 X:142811685-142811707 TTTTTTGTGGCTATTGTAAATGG - Intergenic
1199032722 X:143019698-143019720 TTATTTGTGGCTATTGTAAATGG - Intergenic
1199047946 X:143199199-143199221 TTATATGTGGCTATTGTAAATGG + Intergenic
1199048699 X:143209232-143209254 TTATTTGTGGCTATTGTAAATGG - Intergenic
1199107019 X:143881080-143881102 TTCTTTGGGGCTATAGTAAATGG - Intergenic
1199116128 X:143995237-143995259 CTTTCTGTGGCTATTGTGAATGG - Intergenic
1199210898 X:145209109-145209131 TTATTTGTGGCTATTGTAAATGG - Intergenic
1199272021 X:145895452-145895474 TTATTTGTGGCTATAGTGAATGG + Intergenic
1199354302 X:146843099-146843121 ATTTTTGTGGCTATTGTGAATGG + Intergenic
1199358616 X:146890523-146890545 TTATGTGTGGCTATTGTAAATGG - Intergenic
1199441407 X:147872275-147872297 TTATTTGTGGCTATTGTAAATGG - Intergenic
1199547557 X:149022277-149022299 CTTTTTGTGGCTATTGTGAATGG - Intergenic
1199556533 X:149114858-149114880 GTGTGTGTGGCTATTGTAAATGG - Intergenic
1199739907 X:150725321-150725343 CTTTTTGTGGCTATTGTGAATGG + Intronic
1200330225 X:155288001-155288023 TTGTGTGTGGCAATTGTGAATGG + Intronic
1200334781 X:155338565-155338587 TTTTTTGTGGCTATTGTAAATGG + Intergenic
1200351685 X:155502656-155502678 TTTTTTGTGGCTATTGTAAATGG - Intronic
1200369631 X:155710413-155710435 TTTTGTGTGGCTATTGTAAATGG + Intergenic
1200483301 Y:3735192-3735214 GTGTGTGTGGCAATTGTGAATGG - Intergenic
1200565625 Y:4761972-4761994 TTGTGTGTGGCTATTGTAAATGG + Intergenic
1200570457 Y:4822538-4822560 TTTTTTGTGGCTATTGTGAATGG + Intergenic
1200605338 Y:5256792-5256814 TTATTTGTGGCTATTGTAAATGG + Intronic
1200660808 Y:5954960-5954982 TTATGTGTGGCTATTGTAAATGG - Intergenic
1200814382 Y:7516631-7516653 GTGTATGTGGTTATATTGGAAGG - Intergenic
1201395664 Y:13545002-13545024 CTTTTTGTGGCAATAGTGAATGG - Intergenic
1202023801 Y:20497368-20497390 TTATGTGTGGCTATTGTAAATGG + Intergenic