ID: 926546226

View in Genome Browser
Species Human (GRCh38)
Location 2:14243734-14243756
Sequence AAAGGGATACAGTTTTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926546226_926546231 10 Left 926546226 2:14243734-14243756 CCTGTGGAAAACTGTATCCCTTT No data
Right 926546231 2:14243767-14243789 AATTTGTTTGTTTCTATTCAGGG No data
926546226_926546230 9 Left 926546226 2:14243734-14243756 CCTGTGGAAAACTGTATCCCTTT No data
Right 926546230 2:14243766-14243788 TAATTTGTTTGTTTCTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926546226 Original CRISPR AAAGGGATACAGTTTTCCAC AGG (reversed) Intergenic