ID: 926548474

View in Genome Browser
Species Human (GRCh38)
Location 2:14271525-14271547
Sequence GGTTATTTTTGATCACCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926548474_926548478 11 Left 926548474 2:14271525-14271547 CCATCAGGTGATCAAAAATAACC No data
Right 926548478 2:14271559-14271581 CCTCCACTTAATAACTCCACAGG No data
926548474_926548479 12 Left 926548474 2:14271525-14271547 CCATCAGGTGATCAAAAATAACC No data
Right 926548479 2:14271560-14271582 CTCCACTTAATAACTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926548474 Original CRISPR GGTTATTTTTGATCACCTGA TGG (reversed) Intergenic
No off target data available for this crispr