ID: 926548811

View in Genome Browser
Species Human (GRCh38)
Location 2:14275791-14275813
Sequence TTGTTTATAAATAAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926548808_926548811 3 Left 926548808 2:14275765-14275787 CCTAGAAGCAGTGATGTGCTGAT No data
Right 926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926548811 Original CRISPR TTGTTTATAAATAAGCTGGA GGG Intergenic
No off target data available for this crispr