ID: 926548882

View in Genome Browser
Species Human (GRCh38)
Location 2:14276495-14276517
Sequence AATTGTGACCTGGACATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926548878_926548882 25 Left 926548878 2:14276447-14276469 CCTAAAAATTTTACAACTGGATC No data
Right 926548882 2:14276495-14276517 AATTGTGACCTGGACATTGTAGG No data
926548879_926548882 -4 Left 926548879 2:14276476-14276498 CCAGCATACAAAAGCCTACAATT No data
Right 926548882 2:14276495-14276517 AATTGTGACCTGGACATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926548882 Original CRISPR AATTGTGACCTGGACATTGT AGG Intergenic
No off target data available for this crispr