ID: 926548967

View in Genome Browser
Species Human (GRCh38)
Location 2:14277897-14277919
Sequence TGTAATATGCAGAATGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926548967_926548970 24 Left 926548967 2:14277897-14277919 CCTTACACATTCTGCATATTACA No data
Right 926548970 2:14277944-14277966 AATATTTTCTCCTATTCTGTAGG 0: 232
1: 3157
2: 14774
3: 17972
4: 9612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926548967 Original CRISPR TGTAATATGCAGAATGTGTA AGG (reversed) Intergenic
No off target data available for this crispr