ID: 926549143

View in Genome Browser
Species Human (GRCh38)
Location 2:14279991-14280013
Sequence CAAAGCCTAGCAGTTAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926549143_926549145 0 Left 926549143 2:14279991-14280013 CCATTGTTAACTGCTAGGCTTTG No data
Right 926549145 2:14280014-14280036 TCTCCCCTATAGGAGTCTCCTGG No data
926549143_926549152 20 Left 926549143 2:14279991-14280013 CCATTGTTAACTGCTAGGCTTTG No data
Right 926549152 2:14280034-14280056 TGGAAACCTAGCAGAAGGTAGGG No data
926549143_926549149 15 Left 926549143 2:14279991-14280013 CCATTGTTAACTGCTAGGCTTTG No data
Right 926549149 2:14280029-14280051 TCTCCTGGAAACCTAGCAGAAGG No data
926549143_926549151 19 Left 926549143 2:14279991-14280013 CCATTGTTAACTGCTAGGCTTTG No data
Right 926549151 2:14280033-14280055 CTGGAAACCTAGCAGAAGGTAGG No data
926549143_926549144 -10 Left 926549143 2:14279991-14280013 CCATTGTTAACTGCTAGGCTTTG No data
Right 926549144 2:14280004-14280026 CTAGGCTTTGTCTCCCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926549143 Original CRISPR CAAAGCCTAGCAGTTAACAA TGG (reversed) Intergenic
No off target data available for this crispr