ID: 926549147

View in Genome Browser
Species Human (GRCh38)
Location 2:14280018-14280040
Sequence GTTTCCAGGAGACTCCTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926549147_926549151 -8 Left 926549147 2:14280018-14280040 CCCTATAGGAGTCTCCTGGAAAC No data
Right 926549151 2:14280033-14280055 CTGGAAACCTAGCAGAAGGTAGG No data
926549147_926549152 -7 Left 926549147 2:14280018-14280040 CCCTATAGGAGTCTCCTGGAAAC No data
Right 926549152 2:14280034-14280056 TGGAAACCTAGCAGAAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926549147 Original CRISPR GTTTCCAGGAGACTCCTATA GGG (reversed) Intergenic
No off target data available for this crispr