ID: 926549148

View in Genome Browser
Species Human (GRCh38)
Location 2:14280019-14280041
Sequence GGTTTCCAGGAGACTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926549148_926549152 -8 Left 926549148 2:14280019-14280041 CCTATAGGAGTCTCCTGGAAACC No data
Right 926549152 2:14280034-14280056 TGGAAACCTAGCAGAAGGTAGGG No data
926549148_926549151 -9 Left 926549148 2:14280019-14280041 CCTATAGGAGTCTCCTGGAAACC No data
Right 926549151 2:14280033-14280055 CTGGAAACCTAGCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926549148 Original CRISPR GGTTTCCAGGAGACTCCTAT AGG (reversed) Intergenic
No off target data available for this crispr