ID: 926549151

View in Genome Browser
Species Human (GRCh38)
Location 2:14280033-14280055
Sequence CTGGAAACCTAGCAGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926549148_926549151 -9 Left 926549148 2:14280019-14280041 CCTATAGGAGTCTCCTGGAAACC No data
Right 926549151 2:14280033-14280055 CTGGAAACCTAGCAGAAGGTAGG No data
926549147_926549151 -8 Left 926549147 2:14280018-14280040 CCCTATAGGAGTCTCCTGGAAAC No data
Right 926549151 2:14280033-14280055 CTGGAAACCTAGCAGAAGGTAGG No data
926549146_926549151 -7 Left 926549146 2:14280017-14280039 CCCCTATAGGAGTCTCCTGGAAA No data
Right 926549151 2:14280033-14280055 CTGGAAACCTAGCAGAAGGTAGG No data
926549143_926549151 19 Left 926549143 2:14279991-14280013 CCATTGTTAACTGCTAGGCTTTG No data
Right 926549151 2:14280033-14280055 CTGGAAACCTAGCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926549151 Original CRISPR CTGGAAACCTAGCAGAAGGT AGG Intergenic
No off target data available for this crispr