ID: 926551515

View in Genome Browser
Species Human (GRCh38)
Location 2:14307083-14307105
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926551513_926551515 5 Left 926551513 2:14307055-14307077 CCTTGTGAATTCAGATGGGTTCC No data
Right 926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr