ID: 926551887

View in Genome Browser
Species Human (GRCh38)
Location 2:14310959-14310981
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926551886_926551887 -1 Left 926551886 2:14310937-14310959 CCAATTGGTATTAGCTTGGCTTA No data
Right 926551887 2:14310959-14310981 ATGTTTGACCTAAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr