ID: 926562638

View in Genome Browser
Species Human (GRCh38)
Location 2:14434715-14434737
Sequence CACAAGAACAGGCCCCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926562632_926562638 -1 Left 926562632 2:14434693-14434715 CCGGCTGGCTGCTTTGGGTGCCC No data
Right 926562638 2:14434715-14434737 CACAAGAACAGGCCCCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926562638 Original CRISPR CACAAGAACAGGCCCCGGGC AGG Intergenic
No off target data available for this crispr