ID: 926570021

View in Genome Browser
Species Human (GRCh38)
Location 2:14519541-14519563
Sequence GGAATTGCCCTTCTTTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926570016_926570021 18 Left 926570016 2:14519500-14519522 CCTTACAGAAAAGAAAAAAATAT No data
Right 926570021 2:14519541-14519563 GGAATTGCCCTTCTTTGTAGAGG No data
926570015_926570021 25 Left 926570015 2:14519493-14519515 CCATCAGCCTTACAGAAAAGAAA No data
Right 926570021 2:14519541-14519563 GGAATTGCCCTTCTTTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926570021 Original CRISPR GGAATTGCCCTTCTTTGTAG AGG Intergenic
No off target data available for this crispr