ID: 926572333

View in Genome Browser
Species Human (GRCh38)
Location 2:14543491-14543513
Sequence ATTTTTCAGCCTTGTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926572333_926572339 24 Left 926572333 2:14543491-14543513 CCTCCTGGACAAGGCTGAAAAAT No data
Right 926572339 2:14543538-14543560 ACAAATAGGTCATGGTGTCATGG No data
926572333_926572338 16 Left 926572333 2:14543491-14543513 CCTCCTGGACAAGGCTGAAAAAT No data
Right 926572338 2:14543530-14543552 GAAAGAAAACAAATAGGTCATGG No data
926572333_926572337 10 Left 926572333 2:14543491-14543513 CCTCCTGGACAAGGCTGAAAAAT No data
Right 926572337 2:14543524-14543546 GCAGTTGAAAGAAAACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926572333 Original CRISPR ATTTTTCAGCCTTGTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr