ID: 926580234

View in Genome Browser
Species Human (GRCh38)
Location 2:14626738-14626760
Sequence TTATATACGAAGGTGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926580226_926580234 14 Left 926580226 2:14626701-14626723 CCATGCAACTGGGAAGCAGTTAG No data
Right 926580234 2:14626738-14626760 TTATATACGAAGGTGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926580234 Original CRISPR TTATATACGAAGGTGGAGAG AGG Intergenic
No off target data available for this crispr