ID: 926580946

View in Genome Browser
Species Human (GRCh38)
Location 2:14632726-14632748
Sequence CCCACTGGACAGTCCCGGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926580946_926580952 6 Left 926580946 2:14632726-14632748 CCGAGCCGGGACTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG 0: 1
1: 0
2: 1
3: 19
4: 250
926580946_926580958 16 Left 926580946 2:14632726-14632748 CCGAGCCGGGACTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 926580958 2:14632765-14632787 AGCGCAGACCTGGAGGCGCACGG 0: 1
1: 0
2: 0
3: 14
4: 164
926580946_926580959 17 Left 926580946 2:14632726-14632748 CCGAGCCGGGACTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 926580959 2:14632766-14632788 GCGCAGACCTGGAGGCGCACGGG 0: 1
1: 0
2: 0
3: 8
4: 112
926580946_926580950 -9 Left 926580946 2:14632726-14632748 CCGAGCCGGGACTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 926580950 2:14632740-14632762 TCCAGTGGGAGCAGGCGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 193
926580946_926580955 9 Left 926580946 2:14632726-14632748 CCGAGCCGGGACTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 926580955 2:14632758-14632780 CCCGGCCAGCGCAGACCTGGAGG 0: 1
1: 0
2: 3
3: 31
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926580946 Original CRISPR CCCACTGGACAGTCCCGGCT CGG (reversed) Exonic