ID: 926580948

View in Genome Browser
Species Human (GRCh38)
Location 2:14632731-14632753
Sequence CTGCTCCCACTGGACAGTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926580948_926580958 11 Left 926580948 2:14632731-14632753 CCGGGACTGTCCAGTGGGAGCAG 0: 1
1: 0
2: 3
3: 22
4: 251
Right 926580958 2:14632765-14632787 AGCGCAGACCTGGAGGCGCACGG 0: 1
1: 0
2: 0
3: 14
4: 164
926580948_926580952 1 Left 926580948 2:14632731-14632753 CCGGGACTGTCCAGTGGGAGCAG 0: 1
1: 0
2: 3
3: 22
4: 251
Right 926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG 0: 1
1: 0
2: 1
3: 19
4: 250
926580948_926580959 12 Left 926580948 2:14632731-14632753 CCGGGACTGTCCAGTGGGAGCAG 0: 1
1: 0
2: 3
3: 22
4: 251
Right 926580959 2:14632766-14632788 GCGCAGACCTGGAGGCGCACGGG 0: 1
1: 0
2: 0
3: 8
4: 112
926580948_926580955 4 Left 926580948 2:14632731-14632753 CCGGGACTGTCCAGTGGGAGCAG 0: 1
1: 0
2: 3
3: 22
4: 251
Right 926580955 2:14632758-14632780 CCCGGCCAGCGCAGACCTGGAGG 0: 1
1: 0
2: 3
3: 31
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926580948 Original CRISPR CTGCTCCCACTGGACAGTCC CGG (reversed) Exonic