ID: 926580951

View in Genome Browser
Species Human (GRCh38)
Location 2:14632741-14632763
Sequence GCCGGGGCGCCTGCTCCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926580951_926580965 29 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580965 2:14632793-14632815 GCACCGCACGATTCGGCTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 10
926580951_926580955 -6 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580955 2:14632758-14632780 CCCGGCCAGCGCAGACCTGGAGG 0: 1
1: 0
2: 3
3: 31
4: 261
926580951_926580964 28 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580964 2:14632792-14632814 CGCACCGCACGATTCGGCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 8
926580951_926580952 -9 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG 0: 1
1: 0
2: 1
3: 19
4: 250
926580951_926580958 1 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580958 2:14632765-14632787 AGCGCAGACCTGGAGGCGCACGG 0: 1
1: 0
2: 0
3: 14
4: 164
926580951_926580959 2 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580959 2:14632766-14632788 GCGCAGACCTGGAGGCGCACGGG 0: 1
1: 0
2: 0
3: 8
4: 112
926580951_926580961 22 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580961 2:14632786-14632808 GGGCGCCGCACCGCACGATTCGG 0: 1
1: 0
2: 0
3: 1
4: 20
926580951_926580963 27 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580963 2:14632791-14632813 CCGCACCGCACGATTCGGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926580951 Original CRISPR GCCGGGGCGCCTGCTCCCAC TGG (reversed) Exonic