ID: 926580951

View in Genome Browser
Species Human (GRCh38)
Location 2:14632741-14632763
Sequence GCCGGGGCGCCTGCTCCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926580951_926580952 -9 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG 0: 1
1: 0
2: 1
3: 19
4: 250
926580951_926580955 -6 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580955 2:14632758-14632780 CCCGGCCAGCGCAGACCTGGAGG 0: 1
1: 0
2: 3
3: 31
4: 261
926580951_926580961 22 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580961 2:14632786-14632808 GGGCGCCGCACCGCACGATTCGG 0: 1
1: 0
2: 0
3: 1
4: 20
926580951_926580958 1 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580958 2:14632765-14632787 AGCGCAGACCTGGAGGCGCACGG 0: 1
1: 0
2: 0
3: 14
4: 164
926580951_926580964 28 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580964 2:14632792-14632814 CGCACCGCACGATTCGGCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 8
926580951_926580965 29 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580965 2:14632793-14632815 GCACCGCACGATTCGGCTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 10
926580951_926580959 2 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580959 2:14632766-14632788 GCGCAGACCTGGAGGCGCACGGG 0: 1
1: 0
2: 0
3: 8
4: 112
926580951_926580963 27 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580963 2:14632791-14632813 CCGCACCGCACGATTCGGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926580951 Original CRISPR GCCGGGGCGCCTGCTCCCAC TGG (reversed) Exonic
900247031 1:1641148-1641170 ACCGGGGCGAGTGCTGCCACAGG + Intronic
900258254 1:1708280-1708302 ACCGGGGCGAGTGCTGCCACAGG + Intronic
900350734 1:2233298-2233320 GCCGGGGGTCCTGCTCCGAGGGG + Intronic
900972044 1:5997138-5997160 GCTGGGGCGCCTCGTCCGACTGG - Intronic
901887016 1:12230303-12230325 CCCTGGGCGTCTGCTCCCCCCGG + Intronic
902936260 1:19766940-19766962 GCCCTGGCACCTGCTCCCATTGG + Intronic
903668721 1:25023005-25023027 GACGGGGCGTCTGCTCGCTCTGG + Intergenic
905847021 1:41241947-41241969 GCCGCTGCGCCTGCTCCCCCGGG - Intronic
907223907 1:52927408-52927430 GCAGGGTCGCAGGCTCCCACGGG - Exonic
910251097 1:85200575-85200597 GCCCGGGCGGCTGCACCCACCGG - Exonic
916091925 1:161314338-161314360 GCCGGCGCGCCTCCGCCCTCGGG + Exonic
917920201 1:179744128-179744150 GCCGAGACGCCGGCTCCCACAGG - Intronic
920560546 1:206935544-206935566 GCCGGGACGCCGGCTTCTACTGG - Exonic
1064230981 10:13529046-13529068 GCCGGCGCCCCTCCTCCCGCGGG - Intergenic
1066746193 10:38605302-38605324 CCTGGGGCCCCGGCTCCCACTGG + Intergenic
1073544657 10:104338106-104338128 GCGCGGGCGCCTGCTCCTCCCGG - Intronic
1075705377 10:124497296-124497318 GCAGGGGGGGCTGCGCCCACTGG - Intronic
1076728012 10:132422246-132422268 GCCGGGGCGGCAGCTTCCAGTGG - Intergenic
1076850072 10:133088334-133088356 GCCGCGGCGCCTGCTCTGCCTGG - Intronic
1077096947 11:803085-803107 GCAGGGGCCTCTGCACCCACAGG - Intronic
1077137060 11:1005563-1005585 GCCAGGGCCCCTGCAGCCACAGG - Intronic
1077380537 11:2234983-2235005 GGCGGGGAGGCTGCTTCCACTGG - Intergenic
1077380745 11:2236112-2236134 GGCGGGGAGGCTGCTTCCACTGG - Intergenic
1077430968 11:2515840-2515862 GCCGGGCCACCTGCACCCTCCGG + Intronic
1078190738 11:9091254-9091276 GCGGGGGCCTCTGCTCCCCCCGG - Intronic
1089660222 11:119980848-119980870 ACGGGGGAGCCTGCTGCCACTGG - Intergenic
1090176753 11:124656814-124656836 GCTGGAGCGCCTGCTCCCTGAGG - Intronic
1090398311 11:126433419-126433441 CCAGGGGCGCCAGCTCCCTCTGG - Intronic
1091302317 11:134515378-134515400 TCCAGGGCGCCTTCTCCCTCAGG - Intergenic
1096482415 12:51951586-51951608 GCCGCGGCGCCGGCTCCGCCGGG + Intergenic
1096599977 12:52722239-52722261 GCCTGGGGTCCTGCCCCCACTGG - Intergenic
1106328275 13:28715501-28715523 ACCAGGGGGCCTGCTCCTACAGG + Intronic
1108345022 13:49537119-49537141 GCCGAGGCACCTGCTCACCCTGG - Intronic
1114485116 14:23057484-23057506 GCCGCGGCGCCCGCTCCAATCGG - Exonic
1122144957 14:99683742-99683764 CCCGGGGCGCCTCCTCCGCCCGG - Intergenic
1122548521 14:102538120-102538142 AGTGGGGCTCCTGCTCCCACGGG - Intergenic
1122719664 14:103715264-103715286 CCAGGCCCGCCTGCTCCCACAGG + Intronic
1122893580 14:104744220-104744242 CCCGGGACCCCTGCTCCCCCAGG - Intronic
1122930904 14:104932720-104932742 ACTGGGGCGCCGGCTCCCACAGG - Intronic
1125956094 15:43792237-43792259 GCCCGGGAGCCGGCTCCCATTGG - Intronic
1130235387 15:82128418-82128440 GCCTGGGCTCCAGCCCCCACTGG - Intergenic
1130927302 15:88395381-88395403 GCCCGGTTGCCTGCTCCCCCTGG - Intergenic
1132386156 15:101401474-101401496 GCCTCGACGCCTGCTCCCAAGGG + Intronic
1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG + Exonic
1132576282 16:665866-665888 GCGGGGCCGCCTCCTCCCTCTGG + Intronic
1132602573 16:780189-780211 GCCCCGGCCCCTGCTCCCGCCGG - Intronic
1132743363 16:1426905-1426927 GCCGGGGCGCCTGTGTCCCCGGG + Intergenic
1135137419 16:19895303-19895325 GCCAGGGCCCCTGCCCTCACAGG + Intergenic
1135725309 16:24849751-24849773 GCCGGGTCCCCTGCACTCACTGG + Intronic
1136458903 16:30397976-30397998 GTCGGGGGGGCTGCTCCCCCCGG - Exonic
1141143953 16:81515925-81515947 TCCGTGGCTCCAGCTCCCACTGG + Intronic
1141445571 16:84055617-84055639 GCCAGGGCGGCTGCTGCCATTGG + Intronic
1142136840 16:88455443-88455465 CCCGGGGCGCCTCCTCCCCATGG + Intronic
1142138772 16:88463333-88463355 GTCTGGGCGCCTGCTGCCAGAGG - Intronic
1142186500 16:88697359-88697381 GCAGGGCCGCCTGGTCCCACCGG - Exonic
1142367432 16:89657520-89657542 GGCGGGGCCGCTTCTCCCACTGG - Intronic
1143211521 17:5191694-5191716 GCCGCGGCGCCTGCGTCCACCGG - Intronic
1143345590 17:6246597-6246619 GCCAGGGCGCATGCTTCCCCTGG + Intergenic
1145413629 17:22694855-22694877 GCTGAGGCGCCTGCGCCCATGGG - Intergenic
1146843452 17:36169551-36169573 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146848547 17:36201686-36201708 CCTGGGGCGCCTGCTGCCAAAGG - Intronic
1146864860 17:36330886-36330908 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1146871667 17:36381400-36381422 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146879026 17:36432482-36432504 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146882967 17:36453628-36453650 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1146886303 17:36473198-36473220 GCAAGGGAGCCAGCTCCCACTGG - Intergenic
1147067719 17:37931480-37931502 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147074553 17:37982024-37982046 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147079250 17:38011035-38011057 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147086076 17:38061563-38061585 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147095189 17:38134977-38134999 GCCCGGGCTCCTGCTGCCATCGG + Intergenic
1147102021 17:38185528-38185550 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1147752493 17:42744856-42744878 GGAGGGGCGCCTGCTACCCCCGG + Intronic
1148621524 17:49038310-49038332 GCTGGGGCCCCCGCTGCCACAGG - Exonic
1148787110 17:50150831-50150853 GGCAGGGCGCGCGCTCCCACCGG - Intergenic
1149846612 17:60012038-60012060 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1152634139 17:81423547-81423569 GGCGGGGGGCCTGCCCCCTCGGG - Intronic
1153814218 18:8779083-8779105 GCCGGGGCGCCAGCTTCCTTTGG - Intronic
1154161160 18:11981609-11981631 GGCGGGACTCCGGCTCCCACCGG - Exonic
1157489590 18:48113500-48113522 GCCGGGGCACCTCCTGCCCCTGG - Intronic
1160390585 18:78528273-78528295 GCCGTGGCGCTTCTTCCCACGGG - Intergenic
1160668487 19:344629-344651 GCCGGGGCGCCTGGCCCGTCCGG - Intronic
1160733910 19:653202-653224 GCCTGGGCACCTCCTCACACAGG + Intronic
1160993881 19:1873017-1873039 GAGGAGGCGCCTGCTCCCAGAGG + Intergenic
1161770509 19:6228449-6228471 GCCGGGGAGCCTGGTCCTCCTGG - Intronic
1161802516 19:6424199-6424221 TCCGGGGCGCCTGCACACCCAGG + Intronic
1162079417 19:8209473-8209495 GCCCGGCCGCCTGCACCCCCAGG + Exonic
1162389470 19:10380580-10380602 GCCGAGACGCCTCCTCCCATTGG + Exonic
1163666923 19:18607574-18607596 GCCTGGGTCCCGGCTCCCACAGG - Intronic
1165886740 19:39084227-39084249 GCCAGGGCCCCGGGTCCCACAGG - Intronic
1165900793 19:39168375-39168397 ACCTGGGCCCCTCCTCCCACAGG + Intronic
1166139662 19:40799311-40799333 GCCGGGGCGCCGGCGCGAACCGG + Intronic
1166341488 19:42140141-42140163 GGCCAGGCGCCTGCTCCCACAGG - Intronic
925351392 2:3203528-3203550 GTCGGGGCGCCTCCTCCAGCTGG + Intronic
926425083 2:12732749-12732771 CCCGGGGCGGCTGCTACCAAGGG - Intronic
926580951 2:14632741-14632763 GCCGGGGCGCCTGCTCCCACTGG - Exonic
932738225 2:74270769-74270791 GCAGGGGCTCCTGAACCCACAGG - Intronic
933834281 2:86232714-86232736 GACGGCGCCCCTGCTCCCTCGGG - Exonic
937132595 2:119524453-119524475 GCCGGCGCGCCTCCTCCACCCGG + Exonic
938406283 2:131034989-131035011 GGCGGGGCGCCTGCGCTCGCGGG - Intronic
946295737 2:218782232-218782254 GCCGTGGCCTCTGCCCCCACGGG + Exonic
946420767 2:219563299-219563321 GAAGGTGCCCCTGCTCCCACTGG - Intronic
947741747 2:232487873-232487895 GCCGGCGCGCCCCCTCCCTCGGG - Intergenic
948699182 2:239749759-239749781 GCGGGGGCAGCTGCTCCCAGCGG - Intergenic
948703666 2:239776527-239776549 GGGTGGGCGCCTGGTCCCACTGG - Intronic
948896538 2:240930365-240930387 GCCAGGGCTACTGCACCCACGGG - Intronic
1170475415 20:16709466-16709488 GCAGGGGCAACTGCTCCAACTGG + Intergenic
1170524691 20:17226596-17226618 GCCGGCGCCCCTGCTCCCCTCGG + Intronic
1171994690 20:31722758-31722780 GCCGGGTCGCATGATCCCTCCGG - Exonic
1177166590 21:17611943-17611965 GCCGGGGCTCCTCACCCCACGGG - Intronic
1180064771 21:45406651-45406673 GCCGGGCCGCCAGCGCCCACAGG + Intronic
1180535684 22:16391573-16391595 CCTGGGGCCCCGGCTCCCACTGG + Intergenic
1181171241 22:21011462-21011484 GCTGGGCCGCCTGCTCCTCCAGG + Intronic
1181178104 22:21049057-21049079 GCTGGGCCGCCTGCTCCTCCAGG - Exonic
1181540630 22:23571164-23571186 GCCGGGGTGCCAGATCCCGCAGG - Intergenic
1182439904 22:30357055-30357077 CCCGGTGCGCCTGCGGCCACCGG - Exonic
1183702205 22:39457193-39457215 GCAGGGGTGCCCGCTCCCGCCGG - Intergenic
1183778506 22:39983668-39983690 GCCGGAGCCCCTGCTCCTGCTGG + Intergenic
1184791277 22:46701579-46701601 GCCGGGCCTCCTGCGCCCCCAGG - Intronic
1185177320 22:49335246-49335268 GCCGAGGCCCCTGCTCCCATCGG - Intergenic
1185213990 22:49588061-49588083 GACGAGGCTCCAGCTCCCACAGG - Intronic
1185395212 22:50583182-50583204 GCCGCCCCGCCGGCTCCCACGGG - Intronic
949531284 3:4958161-4958183 GCTGGGGCTCCTCCGCCCACAGG - Intergenic
951671574 3:25189448-25189470 GCTGGGGCCCCTGCTCCTAGGGG - Intronic
960958259 3:123050510-123050532 CTGGGGGAGCCTGCTCCCACAGG + Intergenic
961333100 3:126154427-126154449 GCCCTGGCCCCTACTCCCACTGG - Intronic
961389114 3:126541987-126542009 GCCTGGCCGCCTGCCCTCACTGG + Exonic
961453692 3:127014112-127014134 GCCGGGGCGCCCACTCACCCTGG - Exonic
963236657 3:142963312-142963334 GCCGCGGCGCCTGCAGCCCCGGG - Exonic
963904627 3:150763249-150763271 GCCGGGGCGCTGGCTCCGCCCGG + Exonic
968230618 3:197002965-197002987 GCCGAGGCGCCTACACCCGCAGG - Exonic
968753378 4:2401822-2401844 GCCGGGACCCCCGCTACCACTGG - Intronic
969256894 4:6008346-6008368 GCCGCTGCACCTGCTCCCGCAGG + Intergenic
969538393 4:7770554-7770576 GCCTGGCCTCCTGCTCCCCCTGG - Intronic
969559792 4:7939688-7939710 GCCGCGGCGCCTGGGCCGACTGG + Exonic
972686776 4:41360337-41360359 GCCGCAGCGCCCGCTCCCCCGGG + Intronic
973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG + Intronic
982261069 4:153494882-153494904 GCCGGGGCTCCTGCTCTGCCGGG + Intronic
988727189 5:33937330-33937352 GCCGGGGCGACTGCTGCGGCCGG + Exonic
998069227 5:139183706-139183728 GCCGGGTGGCCTCTTCCCACAGG - Intronic
1002179896 5:177426037-177426059 GGCGGGGCGCCTGCGGCGACCGG + Intronic
1002927161 6:1611248-1611270 GCCCGGGGGGCTGCTCCCGCTGG - Exonic
1003445923 6:6184344-6184366 GCTGGGGCTCATGCTCCCGCAGG - Intronic
1007835585 6:44671522-44671544 GCTGGGGACCCTGTTCCCACTGG - Intergenic
1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG + Exonic
1017727286 6:157284353-157284375 GCCGGGGCCCCTCCACCCATGGG - Intergenic
1019092093 6:169546370-169546392 ACCTGGGCTCCAGCTCCCACAGG + Intronic
1019143384 6:169962096-169962118 GCCGGGGCGCCTCCTCACCGGGG + Intergenic
1026994655 7:74607615-74607637 GACGGGGCACCTGCTCCCCTCGG + Intergenic
1034593208 7:152162268-152162290 GCTGGGGCCCCTGCTGCCAAAGG - Exonic
1034983050 7:155490574-155490596 GGCGGGGCATCTGCTCCCGCAGG + Intronic
1035340463 7:158157528-158157550 GTCGGGGAGCCTCCTCCCCCTGG + Intronic
1037787599 8:21911987-21912009 GACGGGGCGCCTCCTCCCTAGGG - Exonic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1038204928 8:25457810-25457832 GCCGGCGCGCCTCCTCCCGCAGG + Intronic
1040581879 8:48705045-48705067 GACGGGCCTCCTGCACCCACAGG - Intergenic
1047213897 8:122861900-122861922 CCTGGGGCGCCTCCTCCCGCCGG + Intronic
1048986117 8:139735965-139735987 GCCTGGCCTCCTGCTCCGACAGG - Intronic
1049386261 8:142344512-142344534 GCCGGGGCCGCTGCCTCCACAGG - Intronic
1049389529 8:142360757-142360779 GCCGGGGCGCTTTGTCCCAGGGG - Intronic
1049654676 8:143792361-143792383 ACCGGGGCGCCACCTCCCAGGGG + Exonic
1049803196 8:144527548-144527570 GCCGGCGCGCCTGCTGCCCCTGG - Exonic
1050607534 9:7317145-7317167 GGCGAGGTCCCTGCTCCCACAGG + Intergenic
1056795855 9:89658450-89658472 GCCTCTGCTCCTGCTCCCACAGG - Intergenic
1057949653 9:99359581-99359603 TCCGTGGCTCCTCCTCCCACCGG - Intergenic
1060588716 9:124802635-124802657 GGCAGGGTGCCTGTTCCCACAGG - Intronic
1060994316 9:127867616-127867638 GGCGGGGCCCCTGCTCCGAGGGG - Exonic
1061665959 9:132161351-132161373 GCCGGGGTGCCAGCGCCCATGGG - Intergenic
1061942839 9:133892245-133892267 CCCGGGACACCTGTTCCCACTGG - Intronic
1062577504 9:137215474-137215496 GCCGGGGCCTCTGCTCCTCCTGG + Exonic
1062597088 9:137304321-137304343 GCCGGGGCGCCCGCACCGCCTGG - Intergenic
1185489749 X:512023-512045 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489762 X:512067-512089 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489811 X:512243-512265 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489824 X:512287-512309 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489837 X:512331-512353 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489850 X:512375-512397 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489887 X:512507-512529 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489900 X:512551-512573 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489913 X:512595-512617 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489962 X:512771-512793 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185489987 X:512859-512881 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490035 X:513035-513057 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490072 X:513167-513189 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490133 X:513387-513409 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490146 X:513431-513453 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490171 X:513519-513541 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490184 X:513563-513585 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490197 X:513607-513629 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490234 X:513739-513761 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490247 X:513783-513805 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490308 X:514003-514025 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490369 X:514223-514245 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490418 X:514399-514421 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490443 X:514487-514509 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490528 X:514795-514817 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490589 X:515015-515037 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490626 X:515147-515169 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490663 X:515279-515301 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490676 X:515323-515345 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490713 X:515455-515477 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490774 X:515675-515697 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490811 X:515807-515829 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490860 X:515983-516005 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1185490873 X:516027-516049 GAAGGAGCTCCTGCTCCCACAGG - Intergenic
1187396867 X:18926989-18927011 GCCTGTGCCCCTGCTCCCAAAGG + Intronic
1195221251 X:102746552-102746574 GCTGGGACGCCGGCTCCCCCCGG - Intronic
1195853729 X:109309016-109309038 GCAGGGGAGCCAGCTCCCTCTGG - Intergenic
1200384954 X:155881262-155881284 GCCGTGTCGCCTGCTGCCATTGG + Intergenic