ID: 926580952

View in Genome Browser
Species Human (GRCh38)
Location 2:14632755-14632777
Sequence CGCCCCGGCCAGCGCAGACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926580946_926580952 6 Left 926580946 2:14632726-14632748 CCGAGCCGGGACTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG 0: 1
1: 0
2: 1
3: 19
4: 250
926580951_926580952 -9 Left 926580951 2:14632741-14632763 CCAGTGGGAGCAGGCGCCCCGGC 0: 1
1: 0
2: 0
3: 11
4: 197
Right 926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG 0: 1
1: 0
2: 1
3: 19
4: 250
926580948_926580952 1 Left 926580948 2:14632731-14632753 CCGGGACTGTCCAGTGGGAGCAG 0: 1
1: 0
2: 3
3: 22
4: 251
Right 926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG 0: 1
1: 0
2: 1
3: 19
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926580952 Original CRISPR CGCCCCGGCCAGCGCAGACC TGG Exonic