ID: 926582458

View in Genome Browser
Species Human (GRCh38)
Location 2:14646083-14646105
Sequence TTCTATAAGAAAAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926582458_926582464 11 Left 926582458 2:14646083-14646105 CCCTCCACCTTTTTCTTATAGAA 0: 1
1: 0
2: 1
3: 33
4: 463
Right 926582464 2:14646117-14646139 TAATGTTTTCAGTGAATGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 204
926582458_926582466 13 Left 926582458 2:14646083-14646105 CCCTCCACCTTTTTCTTATAGAA 0: 1
1: 0
2: 1
3: 33
4: 463
Right 926582466 2:14646119-14646141 ATGTTTTCAGTGAATGCCTGGGG 0: 1
1: 0
2: 1
3: 27
4: 308
926582458_926582465 12 Left 926582458 2:14646083-14646105 CCCTCCACCTTTTTCTTATAGAA 0: 1
1: 0
2: 1
3: 33
4: 463
Right 926582465 2:14646118-14646140 AATGTTTTCAGTGAATGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926582458 Original CRISPR TTCTATAAGAAAAAGGTGGA GGG (reversed) Intronic
900004259 1:34355-34377 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
900023986 1:204871-204893 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
900637439 1:3672833-3672855 TCCTCTAAGAAAGGGGTGGAAGG - Intronic
901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG + Intronic
903202841 1:21756538-21756560 TCCAAGAAGAAAAAGGTGGGTGG - Exonic
903432181 1:23314244-23314266 TTAAATAATAAAAGGGTGGAGGG + Intronic
903515210 1:23905785-23905807 TTCTATTAGAGAGAGGTAGAAGG - Intronic
904395455 1:30218270-30218292 TTTTAAAAGAAAAATGGGGAGGG - Intergenic
904712747 1:32443105-32443127 TTCTAAAAGAAAGAGCTGTAAGG - Intergenic
905385579 1:37601479-37601501 TTCTTAAAGAAAAAGGAGGGAGG - Intergenic
908288067 1:62630886-62630908 TTATATAAGAAAAAAGAGGCCGG + Intronic
911452268 1:98078530-98078552 TTCTCTCAGAAAGAGGTTGAGGG + Intergenic
912042145 1:105404705-105404727 TTCAATAAGGAAAGTGTGGATGG - Intergenic
912668713 1:111606378-111606400 TTTTATAAGAAGAAGGTAGCTGG + Intronic
913462928 1:119107592-119107614 TTATATAGGAAACAGGTAGAAGG - Intronic
914389535 1:147207388-147207410 TTCAAAAATAAAAAGTTGGAGGG + Intronic
914707708 1:150184602-150184624 TCATACAAAAAAAAGGTGGAGGG + Intergenic
916524281 1:165594834-165594856 TTTGATAAGAAAAAGTTGTAAGG - Intergenic
916887829 1:169087150-169087172 TTCTATAGGAAAAAGAGAGAAGG - Intergenic
916964049 1:169916863-169916885 TTTCATAAGAAAAGGGTGGCTGG - Intergenic
917894165 1:179471259-179471281 TTCCAAAAGATAAAGATGGAGGG - Intronic
918467689 1:184838133-184838155 TTTTATATGAAAAAGGTATAAGG - Intronic
919036645 1:192319294-192319316 TGATATAAAAAAAAGTTGGAAGG - Intronic
919991882 1:202713053-202713075 TTCTTTAAGCAGAAGGTGGGTGG - Intergenic
920614922 1:207482490-207482512 TTGTATAAGAAAAGAATGGATGG - Intronic
920783399 1:209016715-209016737 TTCTGTAAGAAAGAGCTGGGAGG + Intergenic
921401820 1:214732400-214732422 TCTTATAAGAAAAAAGTGGGAGG - Intergenic
922136174 1:222829200-222829222 TTATCTTAGAAAAAGGTGCAAGG - Intergenic
922434441 1:225589884-225589906 TTTTATTAGAAAAAGCTGCACGG - Intronic
923858114 1:237866211-237866233 TTATAGTAGCAAAAGGTGGAGGG - Intergenic
924006280 1:239615304-239615326 TTCTCTAAGAAAAAGCTGCTTGG - Intronic
924079946 1:240384960-240384982 TCCTTTAAGAAAATGGTAGATGG - Intronic
924209408 1:241749074-241749096 TTAGATAATAAAAAGTTGGAGGG - Intronic
924356297 1:243180118-243180140 TTCCACAATAAAAAGATGGAAGG + Intronic
924356362 1:243180833-243180855 TTCTATAAGCAACAGTTGGTAGG - Intronic
924700558 1:246447840-246447862 TTCTATTTGAAAAAAGTGGGAGG - Intronic
1063913171 10:10853353-10853375 TCCTATAAGAAAAAGAAAGATGG + Intergenic
1064812990 10:19222866-19222888 TTCACTAAGAAAAAGGTGTGGGG + Intronic
1064996618 10:21301939-21301961 TTTTATAGCAAAGAGGTGGAGGG - Intergenic
1066571008 10:36772066-36772088 TCATATAAGAAAAAGGTTTATGG - Intergenic
1067093773 10:43285314-43285336 TTCTAGAAGAGAGAGGAGGAGGG - Intergenic
1068057228 10:52026234-52026256 TTCTAAAAGAAAAAGGAATATGG + Intronic
1069154093 10:65003075-65003097 GGATAAAAGAAAAAGGTGGAAGG - Intergenic
1069383111 10:67860641-67860663 TTCTATAAGAAAAAAGTAGGAGG + Intergenic
1071006866 10:80893573-80893595 ATGTATAAGAAAATGGTGGCTGG + Intergenic
1071110027 10:82144974-82144996 TTTTAAAAGAAAAAGTGGGATGG - Intronic
1071746813 10:88429482-88429504 TTCAAAAAGACAAAGGTGGCTGG + Intronic
1072043316 10:91630255-91630277 GTCTATATGAAAAATGTGTATGG - Exonic
1072197491 10:93128840-93128862 TTCTATAATAAAAATTTAGAAGG - Intergenic
1072233292 10:93431331-93431353 TTCATTAAGAAAAAGGTCTAAGG - Intronic
1072482893 10:95826862-95826884 GGCTACAAGAAAAATGTGGAAGG + Intronic
1072944000 10:99793356-99793378 CACTAAAAGAAAAAGCTGGATGG + Intronic
1073224538 10:101906435-101906457 TGCTATAAGAAAAAGTCTGAAGG + Intronic
1075324119 10:121517021-121517043 TTCCTTAAGAGAAAGGGGGATGG + Intronic
1075508312 10:123046782-123046804 TTCTAGAAGTAAAATATGGAAGG - Intronic
1077616481 11:3678259-3678281 GTCTGAAAGAAAAAGGTGGGTGG - Intronic
1079154411 11:17931382-17931404 TTCTGTAAGAAAAAGGTTCTGGG - Intronic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1080759269 11:35232139-35232161 ATCTATAACATAAAGGTGAATGG - Intronic
1080813410 11:35728723-35728745 TTTTATAATAAAATGTTGGAGGG - Intronic
1081844770 11:46232154-46232176 TGCTAAAAAAAAAAGGTGGGGGG + Intergenic
1084904591 11:72335891-72335913 GTCTATAGGAAAAAGGTACATGG - Intronic
1085227897 11:74939053-74939075 TACTATAAGAAAGAGCTGGCTGG + Intronic
1085758918 11:79224947-79224969 GTCTAAAAAAAAAAGGGGGAGGG + Intronic
1085932757 11:81104809-81104831 TACTATTAGAAAATGGGGGAGGG - Intergenic
1086382989 11:86277587-86277609 TTCTGTAAGAAAAGTTTGGAAGG + Intronic
1086775694 11:90830129-90830151 TTTTTTAAGAAAAAGGCAGAGGG + Intergenic
1087866700 11:103237769-103237791 TTCCATAAGAAACAAGGGGAGGG + Intronic
1087930445 11:103971933-103971955 TTATAGAAGAAAATGGTGAAGGG + Intronic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088939448 11:114438895-114438917 TCCCATAAGAAAAAGAAGGAAGG + Intronic
1089925937 11:122257792-122257814 TTCTAAGAGAAAAGGTTGGATGG - Intergenic
1091377682 12:36403-36425 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1094765594 12:33590680-33590702 TCCTCTTAGAAAAAAGTGGATGG - Intergenic
1095046790 12:37516131-37516153 TTCTATGTGAAAAAGTTGGTGGG - Intergenic
1096725086 12:53555023-53555045 TTCCGTAAGAAAAAAGTGGCCGG + Intronic
1098760430 12:74418057-74418079 TTCTGTTAGGAAAATGTGGATGG + Intergenic
1099397827 12:82163043-82163065 TCCTTTAAGAAGCAGGTGGAGGG - Intergenic
1100143837 12:91653085-91653107 TTTTGTAAGAGCAAGGTGGAAGG - Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1100864311 12:98840106-98840128 CTCTAAAAGAAAAAGAGGGAAGG + Intronic
1101866215 12:108521908-108521930 TTGTATAAAAAAGAGATGGAGGG + Intronic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1102381661 12:112472122-112472144 TTCTTTAAAAAAAAGGCAGAAGG - Intronic
1102436107 12:112925286-112925308 TTGTATGAGGAAAAGGGGGAGGG - Intronic
1104087197 12:125486467-125486489 TTTTATTAGAACAAGGTGGTTGG + Intronic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1105584411 13:21730724-21730746 TTCCAAAAGAAAAATCTGGAAGG + Intergenic
1105716355 13:23069099-23069121 TTTAAAAAGAACAAGGTGGAGGG + Intergenic
1105790073 13:23790010-23790032 TTTTAGAATAAAAAGGTGAAAGG - Intronic
1105958101 13:25302650-25302672 TTTTTTAAGATAAAGGTGGAGGG + Intronic
1107512639 13:41099915-41099937 CTATATAAGAAAAACGTGGCTGG - Intergenic
1108726335 13:53185977-53185999 TTCTACAAAAAAAAAGTGGTTGG - Intergenic
1109365628 13:61352493-61352515 TTATGTAAGAAAAAGAAGGAAGG - Intergenic
1109449964 13:62499340-62499362 TTCTAGAAGAAAAAAATAGAAGG - Intergenic
1109672793 13:65632171-65632193 TTTTCTATGAAAAGGGTGGAGGG - Intergenic
1109830133 13:67774988-67775010 TTCTATAAAAATAATGTGGTTGG + Intergenic
1111684921 13:91489952-91489974 TATTAAAAGAAAAAGGCGGAGGG + Intronic
1112819275 13:103312062-103312084 TGCTATTGGAAAAAGGGGGAGGG + Intergenic
1113224077 13:108140127-108140149 TTCTAAAACAACAAGGTGGTAGG + Intergenic
1113852247 13:113424454-113424476 CTCAAAAAGAAAAGGGTGGATGG - Intronic
1114351025 14:21851379-21851401 TTCCATAAGACAAAAGTAGATGG - Intergenic
1114825441 14:26072130-26072152 TTTTATAAGAAAAATGTGACAGG - Intergenic
1115129726 14:30040756-30040778 TAATAAAGGAAAAAGGTGGAAGG - Intronic
1115136352 14:30113268-30113290 CTCTATAACATAAAAGTGGAAGG + Intronic
1115288682 14:31745966-31745988 TTCTATAAGTAATTGGTGGGCGG + Intronic
1115478224 14:33836530-33836552 TTCAATAAGAAAAAGGTTTGAGG + Intergenic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1116290608 14:43033202-43033224 TTCTATAAGAGCAAAGTAGAGGG + Intergenic
1117074198 14:52085216-52085238 TTCTATAACATAAAAGTGCAAGG - Intergenic
1117178190 14:53166671-53166693 TTCCTTAAAAAAAAGGTGGGGGG - Intergenic
1117894383 14:60465582-60465604 TTCTACAAGATAAAGGTATACGG - Intronic
1119139509 14:72253416-72253438 GTCTTTAAGAAAAAGTTGGCAGG - Intronic
1119146608 14:72320777-72320799 TAATATAAGGATAAGGTGGAAGG + Intronic
1120092748 14:80352388-80352410 TACTGTAAGAAAAATGTAGATGG + Intronic
1121736938 14:96225324-96225346 CTCTATAGCAAAGAGGTGGAAGG - Intronic
1124815935 15:32992148-32992170 TGCTATAAAACAATGGTGGATGG - Intronic
1126482511 15:49141640-49141662 TTTTATAGTAAAAAGTTGGAAGG - Intronic
1126864814 15:52925151-52925173 TTCTATAAAATAAATGAGGAAGG - Intergenic
1127070701 15:55286058-55286080 TTCTCTTAGAAAAAAATGGATGG + Intronic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127447079 15:59074464-59074486 CTCTATAAGATAAAAGTGCAAGG - Intronic
1127887472 15:63214954-63214976 CTCCATAAGAATGAGGTGGAAGG - Intronic
1129106822 15:73315543-73315565 TTCCTTAAGAAAAAGCTGGGGGG + Intergenic
1129650318 15:77482152-77482174 TGCTCTAAGGAAGAGGTGGATGG + Intronic
1130120058 15:81040267-81040289 TTCTACAAGAAAAAGCCGGCAGG + Intronic
1130444751 15:83990409-83990431 TTCGATAAGCACAAGGTGTAGGG - Intronic
1130997563 15:88912448-88912470 TTCTATGAGAAAATGATGGAGGG + Intronic
1131111707 15:89768559-89768581 TACAAAAAGAAAAAAGTGGAGGG - Intronic
1131434732 15:92413818-92413840 TTCTATAAGAAATTGATGGCAGG + Intronic
1131679813 15:94709647-94709669 TTCTTTTAGAAAAAGATGGTCGG - Intergenic
1131911208 15:97205029-97205051 ATCTACAAGAAAAAGATAGAAGG + Intergenic
1132449245 15:101956589-101956611 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
1132822303 16:1880601-1880623 TTTTTTAAGAAAAAAGTGGCTGG - Intronic
1133546223 16:6810223-6810245 TTCTCCAAGAAAAAGAGGGATGG - Intronic
1135022533 16:18974741-18974763 GTCTATAAGAATAAAGTGGCTGG - Intergenic
1135046148 16:19157573-19157595 TTCCATAAGAGAAAGGAAGATGG + Intronic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136154198 16:28371939-28371961 TACTATAAGAAAATGCTGGCCGG + Intergenic
1136208892 16:28743324-28743346 TACTATAAGAAAATGCTGGCCGG - Intergenic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1137528273 16:49256878-49256900 TTTTATAAGAGATAGGTGGGAGG + Intergenic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1139059172 16:63227591-63227613 TTCTATAACATAAAAGTGCAAGG - Intergenic
1140030211 16:71330421-71330443 TTCTAGAAGAAAAACATAGAGGG + Intergenic
1140718695 16:77750746-77750768 TTTTTTATGAAAAAGATGGATGG + Intergenic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1142406400 16:89892621-89892643 TTCCATAAGGGAAAGGTCGATGG - Intronic
1142655798 17:1392904-1392926 TTCACTAAGACAAAGGTGGCCGG + Intronic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1143733095 17:8892278-8892300 ATCTGTAAGAAAAAGGAGGTGGG + Intronic
1145774467 17:27518374-27518396 TTCTTAAAGAAAAAGGCAGAAGG + Intronic
1147029852 17:37623971-37623993 TTCTATAAGAAACCAGAGGAGGG + Intronic
1148540314 17:48475079-48475101 TTTTTAAAGAAAAAGGTGGAGGG - Intergenic
1148552114 17:48556576-48556598 CTCAAAAAGAAAAAGGGGGAGGG - Intronic
1148996424 17:51714208-51714230 CTCTTTAAGAAAGAGATGGATGG - Intronic
1149267335 17:54941292-54941314 TTCTATATTTAAAAGGGGGAGGG + Intronic
1149279974 17:55092746-55092768 TTTTATGAGAAAAAGGGGAAAGG + Intronic
1149299463 17:55291104-55291126 CTCTATAACAAAAAGGTGCAAGG + Intronic
1151022648 17:70635838-70635860 TACTTAAAGAAAAAGGTGAATGG - Intergenic
1151316264 17:73324406-73324428 TTCTAGAAGATACATGTGGATGG - Intergenic
1153139061 18:1951338-1951360 TTATATGACAAAAAGGTGGATGG - Intergenic
1153332535 18:3888674-3888696 TTTGAGAATAAAAAGGTGGAAGG + Intronic
1153509239 18:5834091-5834113 TTCTATACAAAGCAGGTGGAGGG + Intergenic
1153535335 18:6095903-6095925 TTCTGTAGGCAAAAGTTGGAAGG + Intronic
1155195536 18:23470612-23470634 TTCTTTAAGAAAAAGGCTAAGGG + Intronic
1156100082 18:33583031-33583053 TTCTATAAAATAAAGCTGAATGG + Intronic
1156130076 18:33961973-33961995 TTCTGAAAGAAAAAGGTGCTGGG - Intronic
1158032098 18:52978403-52978425 TTCAACAAGAAAGAGGTGGTCGG + Intronic
1158584928 18:58724456-58724478 TTTCATAAGAAAAAAATGGATGG - Intronic
1159251814 18:65889251-65889273 TTCTTTTTGGAAAAGGTGGAAGG - Exonic
1159513646 18:69429594-69429616 TTCTATAAGGAAAATATTGAGGG + Intronic
1159899409 18:74030789-74030811 TCATAAAAGAAAAAGGTGGCTGG + Intergenic
1160115996 18:76080142-76080164 GTATATAAGAAATAGGTGGCCGG - Intergenic
1160614245 18:80111839-80111861 TTCTAAAAGAAAATGTTGGCCGG - Intronic
1160636011 19:75964-75986 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1162131358 19:8527921-8527943 TTATATAAGAAACAGAAGGAGGG + Intronic
1162882651 19:13671541-13671563 TTCTAGAAAAATAAGGTGGCCGG - Intergenic
1163467647 19:17477852-17477874 TTATTTTAGAAAAAGGTGGGCGG - Intronic
1166439545 19:42800105-42800127 TTCAATAAGAAAAAACTGGATGG + Intronic
1166457583 19:42955646-42955668 TTCAATAAGAAAAAACTGGATGG + Intronic
1166467907 19:43050083-43050105 TTCAATAAGAGAAAACTGGATGG + Intronic
1166474527 19:43110872-43110894 TTCAATAAGAAAAAACTGGATGG + Intronic
1166488498 19:43235950-43235972 TTCAATAAGAGAAAACTGGATGG + Intronic
1166495176 19:43296424-43296446 TTCAATAAGAGAAAATTGGATGG + Intergenic
1166497228 19:43312630-43312652 TACATTAACAAAAAGGTGGAAGG + Intergenic
1167890068 19:52532922-52532944 TGCTTGATGAAAAAGGTGGAAGG + Exonic
925617089 2:5754034-5754056 CTTTATAAGAAACAGGTGCAAGG - Intergenic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927748890 2:25648703-25648725 CTCTTTAAGAAAAAGATGGCTGG + Intronic
928236502 2:29546483-29546505 TTCAATGAGAAACAGGAGGAAGG + Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928649674 2:33391065-33391087 TTCAAAAAAAAAAAGGTGGAGGG - Intronic
928846381 2:35678366-35678388 ACTTATAAGAGAAAGGTGGAAGG - Intergenic
928891289 2:36205943-36205965 TTCTGTGAGAAAAACCTGGATGG + Intergenic
930881206 2:56272513-56272535 TTCTATAAGAAAAGAATGGGAGG - Intronic
931890704 2:66668337-66668359 TTCCAAAATAAAAAGTTGGAAGG - Intergenic
931898461 2:66761025-66761047 TTTTATAACAGAAGGGTGGATGG + Intergenic
932056339 2:68447801-68447823 TTCAAAAAGGAAAAGGTGGCCGG - Intergenic
933360832 2:81282118-81282140 TTCCATTAGAAAAAGGTGGGAGG - Intergenic
933582834 2:84146844-84146866 TTCTAGAAGACAAAGGAGCATGG + Intergenic
935251753 2:101268306-101268328 TGCTATAAGAATATGGTGAAAGG - Intronic
935496420 2:103787936-103787958 TTCCATAAAATAAATGTGGATGG + Intergenic
936565469 2:113579086-113579108 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
936678669 2:114745255-114745277 TTCTAAAAGAAACATGTGGATGG + Intronic
937590495 2:123607562-123607584 TTATATAAGAAAGAGCTGGCGGG + Intergenic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
937647303 2:124280007-124280029 TTCTAGAAGCAAATGCTGGATGG - Intronic
937873310 2:126802098-126802120 TTCTATAAGAAAGAGGGGAAGGG - Intergenic
937979231 2:127604242-127604264 TTCTATAACATAAAAGTGCAAGG - Intronic
938033125 2:128012616-128012638 TTCCTTAAGAAAAAGCTGAATGG + Intronic
938757234 2:134391984-134392006 GTCTATAAGAAAAAGGGAGAAGG - Intronic
939698335 2:145356758-145356780 TTATATAAATAAAAGTTGGAGGG - Intergenic
940120615 2:150260743-150260765 TACTACAAGAGAAAGTTGGATGG + Intergenic
940345133 2:152620941-152620963 TTCTAGAAGAAAGTGGTAGACGG - Intronic
940378705 2:152988329-152988351 CTCTTTAAGAAAAAGTTGGCTGG + Intergenic
941241561 2:163045023-163045045 TTCTTTAAAAAAAAGGTGGGGGG + Intergenic
942377412 2:175352029-175352051 CTCTATAAGAGAAAGGCAGAGGG - Intergenic
942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG + Intergenic
942667676 2:178337766-178337788 TTCTGTTAGAAAAAGGGTGATGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943094172 2:183408798-183408820 TTCTCTAAGAAAAGGGAGGTTGG + Intergenic
943960420 2:194256000-194256022 TTATTTAAAAAAAAGGTGGAGGG + Intergenic
944560465 2:200931447-200931469 TGCTTTAAAAAAAAGGAGGAGGG + Exonic
944769513 2:202899338-202899360 TTCAAGAAGAAACAGGTGGCTGG - Intronic
944804262 2:203265579-203265601 TTATATAAAATAAAGGTAGAAGG - Intronic
944955663 2:204805518-204805540 TTCTAAAAAATAAAGGAGGAGGG + Intronic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946572911 2:221043768-221043790 TGCTATAAAACAAACGTGGAAGG + Intergenic
946869297 2:224071491-224071513 ACCTACAAGAAAAAGGTGAATGG + Intergenic
947094208 2:226547594-226547616 TTCTGTATAAAAGAGGTGGAAGG - Intergenic
947693266 2:232160147-232160169 TTCTAGAATAAAGAGGTAGATGG - Intronic
948109857 2:235445683-235445705 TTCTTCCAGAAAAAGGTGGGAGG - Intergenic
948243438 2:236457668-236457690 TCCTATAAGAGAGAGGTAGAAGG + Intronic
1169611746 20:7388779-7388801 TTCTAGAAGAAAAAGGTGTGGGG - Intergenic
1169615327 20:7437155-7437177 TTCTATATCCAAAAGGTGAAGGG - Intergenic
1169729497 20:8771603-8771625 TTCTATAAAAACAAAGTTGAAGG - Intronic
1169833009 20:9845874-9845896 TTCAAGAAGAATAAGGTGGGAGG + Intergenic
1170594878 20:17797719-17797741 TTAAATAAGAAACAGATGGATGG - Intergenic
1171541350 20:25959781-25959803 TTCTATGTGAAAAAGTTGGTGGG - Intergenic
1171965711 20:31528771-31528793 TACTAAAAGAAAAAGTTGGCCGG - Intronic
1177165176 21:17593960-17593982 TTCTATAAAAATAAGTTTGATGG + Exonic
1177331458 21:19669593-19669615 TTCTATAACATAAAAGTGCAAGG - Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177478586 21:21656412-21656434 TTCTTTAACAAAAACTTGGAAGG - Intergenic
1178237609 21:30860715-30860737 TTCCACAAGAACCAGGTGGAAGG + Intergenic
1178473599 21:32917341-32917363 GTCTCTAAAAAAAAGATGGAGGG + Intergenic
1179285519 21:39974612-39974634 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285532 21:39974686-39974708 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285545 21:39974760-39974782 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285558 21:39974834-39974856 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285571 21:39974908-39974930 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285584 21:39974982-39975004 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285597 21:39975056-39975078 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1181321359 22:22009160-22009182 CTTTATAAGAAAACTGTGGAGGG + Intergenic
1181838083 22:25627395-25627417 TCCTACAGGGAAAAGGTGGAAGG - Intronic
1182579360 22:31295462-31295484 TTCTATAGCAAAAAGCTGAAGGG + Intergenic
1182728292 22:32466557-32466579 TGCTGAAAGGAAAAGGTGGAGGG + Intergenic
1182833511 22:33322824-33322846 TTGTAGAAAAAAAAGGTGGCCGG + Intronic
949221648 3:1641725-1641747 TTGTATAAGACAAATGGGGAAGG + Intergenic
949828915 3:8192930-8192952 TTCTATAAAATAATGGAGGAGGG - Intergenic
949919904 3:8992561-8992583 TTCTACAACAGAAAGCTGGAAGG + Intronic
950271860 3:11623045-11623067 ATCCATAACTAAAAGGTGGATGG - Intronic
951039907 3:17978582-17978604 TTGTAAGAGAAACAGGTGGAAGG - Intronic
951174810 3:19586828-19586850 TTCAATTTGAAAAGGGTGGAAGG - Intergenic
952357721 3:32600213-32600235 TCCAATAAGAAAAAGGACGATGG - Intergenic
952393126 3:32897963-32897985 TTCAAAAAGAAAAAGGTGATGGG + Intergenic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
954544126 3:51418197-51418219 TCCTAAAAGAAAAAGGCGCAAGG + Exonic
955087232 3:55715073-55715095 TTTTAAAAGATTAAGGTGGAAGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956027382 3:64997838-64997860 TGCTAAAAGAAAAAGCTGGCTGG + Intergenic
956027906 3:65003223-65003245 TGCTAAAAGAAAAAGCTGGCTGG - Intergenic
956718017 3:72095357-72095379 TTCTAAAAAAAAAAGGGGGGGGG - Intergenic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957286643 3:78224619-78224641 TCCTTTTAGAAAAATGTGGAAGG - Intergenic
957510381 3:81180463-81180485 ATTTAGAAGAAAAAGGTGAAGGG + Intergenic
957562556 3:81841781-81841803 TTCTATATAAAAGAGGTGTAAGG - Intergenic
957879775 3:86197229-86197251 TTCAAAAAGAGAAAGGTTGAAGG - Intergenic
957959208 3:87227535-87227557 TTCAAGAAGAAAACCGTGGATGG + Exonic
958727568 3:97924397-97924419 ATGAATAAGAAAAAGGTGAAAGG + Intronic
958933488 3:100232419-100232441 TTCTATTAAAAAAAGTAGGAGGG + Intergenic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961075355 3:123977049-123977071 TTCCCTCAGAAGAAGGTGGAAGG - Intronic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
961976956 3:131035701-131035723 TTCTACCAGAAAATGGTGGGAGG - Intronic
962233779 3:133691042-133691064 ATTTATAAGAAAAAGTGGGATGG + Intergenic
962646757 3:137447899-137447921 TTCTATAAGAAAAGGGTGGTAGG + Intergenic
962882092 3:139587882-139587904 TTATAGAAGAAAATGGTGGAAGG + Intronic
963054203 3:141171344-141171366 TTCTTTCAGAAAAAAATGGAGGG - Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
963941613 3:151101613-151101635 TCTCATAAGAAAAAGCTGGAAGG + Intronic
964290158 3:155169717-155169739 TTCTCTAAGACAAGGATGGATGG + Intronic
965097111 3:164244456-164244478 GAATATAACAAAAAGGTGGAGGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
965763464 3:172106164-172106186 CTCTTTAAAAAAAAGGTTGATGG - Intronic
965846686 3:172970335-172970357 TTCTATAAGAATAAGATATAGGG - Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966243422 3:177779771-177779793 TTCTGTTAGAAAAAGGAGGAAGG + Intergenic
966530524 3:180973880-180973902 TGGTATAATAAAAAGCTGGATGG - Intronic
967366412 3:188691473-188691495 TGTAATAATAAAAAGGTGGATGG + Intronic
967384666 3:188899626-188899648 TTCTCTAAGAAAGAGGGAGACGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967571577 3:191035211-191035233 TTCCAAAAGAAAGAAGTGGATGG + Intergenic
967612235 3:191521000-191521022 TTCTAGAAGAAGAAAATGGAAGG + Intergenic
967719931 3:192805243-192805265 TTCTTTATGATAAATGTGGATGG - Intronic
968619633 4:1598042-1598064 TTCTAAAAGAAACACCTGGAAGG + Intergenic
968888064 4:3346600-3346622 TTCTATGGGAGAAAGTTGGATGG + Intronic
969092093 4:4702516-4702538 TTATTTAAGAAACAGGTGGTAGG + Intergenic
969901175 4:10351152-10351174 ATCTATAAGAAAAACCTGCACGG - Intergenic
970750093 4:19348677-19348699 TTCTCTAAGTAAAAGGTATAAGG + Intergenic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971135265 4:23861624-23861646 GTATATAAGAAAAAGATGAATGG + Intronic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971449048 4:26782700-26782722 TTCTAGAAGAAAAGGATGTATGG + Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
972458240 4:39275037-39275059 CTCAATAAGAAAACGGTGGGGGG + Intronic
973127493 4:46605840-46605862 CTTTATAAGAGAAAGGTAGAGGG + Intergenic
974151843 4:58020174-58020196 TTCAATAAGAAAAAAGTATAAGG - Intergenic
975355059 4:73392595-73392617 TGCTATAAGAAAAAGCAGGGGGG - Intergenic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976766541 4:88603827-88603849 TTCTACAACAGAAAGGAGGAGGG - Intronic
977873850 4:102125874-102125896 TTTTATGACAGAAAGGTGGAAGG - Intergenic
978397031 4:108291890-108291912 TTCTTTAAGAAAAAGCTGATGGG + Intergenic
978459541 4:108936232-108936254 TTAAAAAAGAAAAAAGTGGAAGG - Intronic
979245451 4:118498774-118498796 TTCTATAAGCAACAGTTGGTAGG + Intergenic
979245518 4:118499511-118499533 TTCCACAATAAAAAGATGGAAGG - Intergenic
980170680 4:129286042-129286064 TGCTTTAAGAAAAATGTGGTTGG + Intergenic
980287679 4:130801957-130801979 TTCCAAAAGATAAAGGAGGAAGG - Intergenic
980800689 4:137745747-137745769 TACTATTAAAAAAAGCTGGATGG + Intergenic
981676912 4:147353255-147353277 TTGTAAAAGAAACAGGGGGATGG - Intergenic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
982494591 4:156074945-156074967 TTTTGTAAGAAAAAGGGGGGGGG - Intergenic
983288563 4:165770986-165771008 ATATATAGGAAAAGGGTGGATGG + Intergenic
983783801 4:171706662-171706684 TTCTGTAAGAAAAATGGAGAAGG - Intergenic
984704360 4:182836928-182836950 TTCAGGCAGAAAAAGGTGGAAGG - Intergenic
985101672 4:186464226-186464248 GTCTTTAAGAAAAAGGAGGGGGG + Intronic
985197352 4:187446010-187446032 TTCTGGTAGAAAAATGTGGAAGG - Intergenic
985618907 5:942595-942617 TTCTAGAAGAAAACAGAGGAAGG - Intergenic
985756528 5:1722795-1722817 TTCAAAAAGAAAATGGTGGGGGG - Intergenic
985865661 5:2512140-2512162 TTTAATAAGAAAATAGTGGAAGG - Intergenic
986415557 5:7524815-7524837 TTCTATGTGAAAGAGTTGGATGG - Intronic
987288259 5:16481971-16481993 TTCTAAAAGATACAGGAGGAAGG + Intronic
987365207 5:17142445-17142467 TTCTATAAGAAAAGGTTCAAGGG + Intronic
988203760 5:28105589-28105611 TCCTTTAAAAATAAGGTGGAAGG + Intergenic
988419738 5:30990772-30990794 GGCTATAAGAAAAAGATAGAAGG - Intergenic
988645155 5:33086823-33086845 CTATATAGGAAAGAGGTGGAGGG + Intergenic
989508001 5:42249755-42249777 TTATAGAAGAAAAAAGTAGATGG - Intergenic
990084983 5:51964967-51964989 TTCTATAGGGCAAAGGTGAAAGG - Intergenic
990345169 5:54864824-54864846 TTCTATAGGAATACTGTGGAAGG + Intergenic
991228664 5:64303713-64303735 CTCTATAACAAAAAAGTGCAAGG + Intronic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
992836048 5:80642396-80642418 CTCCATAAGAAAAAAGTGCAAGG + Intronic
993396939 5:87401307-87401329 TTTTTTAAGAGAAAGGTAGAAGG - Intronic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
994601247 5:101908162-101908184 TGCTATGACAAAAAGGTGGAGGG + Intergenic
995605109 5:113845664-113845686 TTTTACAAGAAAAATCTGGAGGG + Intergenic
995971206 5:117973636-117973658 CTCTATTAGAACAACGTGGAGGG - Intergenic
996066061 5:119080530-119080552 TTGTATAAGAAAAATGTGGGAGG - Intronic
996664833 5:126047071-126047093 GTCTATAAGGAATAAGTGGAAGG - Intergenic
996720877 5:126628953-126628975 TACTATAACAGAGAGGTGGATGG - Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
998046125 5:138988232-138988254 TTCTGTAAGAACCAGGTGTACGG - Intronic
998665446 5:144292090-144292112 TATTATGAGAAAAAGTTGGAGGG + Intronic
999158371 5:149474586-149474608 TCCTAGAAGAAATGGGTGGATGG - Intergenic
999707620 5:154288070-154288092 TTCTTTGAGAGGAAGGTGGAGGG + Intronic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1001899579 5:175414821-175414843 TACTATGAAAAAAAGGAGGAAGG - Intergenic
1003438109 6:6112505-6112527 TTATAAAAGAAAAAGTTGGAGGG - Intergenic
1003510634 6:6776998-6777020 TAATACATGAAAAAGGTGGAAGG - Intergenic
1005235779 6:23760657-23760679 TTCTATAAAAAGAAAGTAGATGG + Intergenic
1005333574 6:24771739-24771761 TTCAATAAGGCAAAGGTGGTGGG - Intergenic
1005897483 6:30190522-30190544 TTCTATTATTAAAAGGAGGAAGG - Intronic
1006970845 6:38043463-38043485 AGCTAAAAGAAAAAGGTGGAGGG - Intronic
1007138572 6:39547557-39547579 TTTTTTTAAAAAAAGGTGGAGGG - Intronic
1007294121 6:40808739-40808761 ATCTATAGGAAAAATGTTGAAGG + Intergenic
1007525874 6:42492556-42492578 TTATGTAAGAAAAATGTGGCAGG - Intergenic
1007890809 6:45289414-45289436 TTTGATAAAAGAAAGGTGGATGG - Intronic
1007985165 6:46200160-46200182 TTATTTAAAAAAAATGTGGAAGG + Intergenic
1008199591 6:48569686-48569708 TTCTTTAAAAATAAGGTGAAGGG - Intergenic
1008696317 6:54042388-54042410 TCAAAGAAGAAAAAGGTGGAGGG - Intronic
1010139923 6:72602323-72602345 TTCTATGTGAGAAAAGTGGAGGG - Intergenic
1010819222 6:80394021-80394043 TTCTATAAGTAAATGGAGTAAGG - Intergenic
1011349216 6:86403959-86403981 TTGTATAATAAAAAGATGAATGG + Intergenic
1011443200 6:87408994-87409016 TACTATAAGGAAAAAGTGGTAGG - Intronic
1012012770 6:93811251-93811273 TTCTATAGTATAAATGTGGAAGG + Intergenic
1012346415 6:98193044-98193066 AATTATAACAAAAAGGTGGAGGG - Intergenic
1012412977 6:98980791-98980813 TGCCATAAGAAAAGGCTGGATGG - Intergenic
1012617544 6:101295069-101295091 TACTATAAGAAAAAAGTGTTTGG - Intergenic
1012690408 6:102304049-102304071 TTCCATAAAATAAAGGAGGAAGG + Intergenic
1012963454 6:105647116-105647138 TTCTAGAAAAAAAAAGAGGAAGG + Intergenic
1013142857 6:107356468-107356490 TGCTACAGAAAAAAGGTGGAAGG - Intronic
1013929382 6:115512848-115512870 TTAAATAATAAAATGGTGGAAGG - Intergenic
1015247635 6:131092448-131092470 ATATATAAAAAAAAGATGGAAGG + Intergenic
1015263359 6:131263743-131263765 TTTTATAAGAGAAGGGTGAAGGG + Intronic
1015863763 6:137707231-137707253 TTCTATAAGATAAAGATAGTAGG + Intergenic
1017435566 6:154412489-154412511 TTCTATCAGAAACTGGAGGAAGG - Intronic
1018325553 6:162663920-162663942 CTCTAAAAAAAAAAGGTGGGGGG + Intronic
1018460233 6:163991419-163991441 TTCAATCAAAAAAAGGAGGAAGG + Intergenic
1018572020 6:165221970-165221992 ATCTAAAAGCAACAGGTGGATGG + Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1022975268 7:35550487-35550509 TTCTGAAAGGAAAAGTTGGACGG + Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1024115545 7:46189615-46189637 TCCTATCAGAAGAAGGTGAAGGG + Intergenic
1024565810 7:50679638-50679660 TTCCATATGAAAATGGGGGAAGG - Intronic
1024818792 7:53303192-53303214 TACTATAAGAAGGAGGTGGGAGG + Intergenic
1025292792 7:57745988-57746010 TTCTATGTGAAAAAGTTGGTAGG - Intergenic
1026078559 7:67196565-67196587 TTCCATAAGGAAAAAGTGAAAGG - Intronic
1026374199 7:69733858-69733880 TACTATGAGAAAAAGGTGAGTGG - Intronic
1027066000 7:75124003-75124025 TTCTAAAAAAAAAAGGGGGGGGG - Intronic
1027357509 7:77372654-77372676 TTGTATAAGTAAAAGGTAAACGG + Intronic
1028215252 7:88123918-88123940 ATCTATAATAAAAAGGTGCTTGG - Intronic
1028354458 7:89888631-89888653 TTCTATAAGAAGAGGAGGGATGG - Intergenic
1028491132 7:91413644-91413666 CTCAATAAGAAAAGAGTGGATGG + Intergenic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1030494943 7:110287268-110287290 TTCCATAAGATAAAAGTGCAAGG - Intergenic
1031670656 7:124540546-124540568 TTCTATTTGAAAAAGTTGAATGG + Intergenic
1032719967 7:134542845-134542867 ATATATAATAAAAATGTGGATGG - Intergenic
1033585230 7:142769975-142769997 TTCAATAACAAAGATGTGGAGGG - Intergenic
1033676755 7:143548504-143548526 TTCCATAAGATAAAAGGGGAGGG - Intergenic
1033883999 7:145921722-145921744 CTCTATAAGAAAACAGTGTAAGG + Intergenic
1034219083 7:149430752-149430774 TTCTATAAGAGAGAGCTGGAGGG + Intergenic
1036127518 8:6076535-6076557 TTCTTTCAGAAGCAGGTGGAGGG - Intergenic
1037218506 8:16487452-16487474 GTCTATAACATAAAGGTGCAAGG - Intronic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1038168706 8:25109102-25109124 TTCAGTAAGAAAAAGTTGGATGG - Intergenic
1039773184 8:40709457-40709479 GCCTTTAAGAAAAAGATGGAAGG + Intronic
1040880670 8:52201206-52201228 TTCTTGAAGGAAAAGCTGGAAGG - Intronic
1042276514 8:67010421-67010443 CTCTAGAAGAAAAAGTTTGATGG + Intronic
1042548058 8:69968570-69968592 CTCTATAACATAAAAGTGGAAGG + Intergenic
1043357959 8:79435967-79435989 TTCTATAAGAGGAACATGGAAGG - Intergenic
1043943230 8:86220346-86220368 TTCTTCTAGAAAAAGGTGTATGG - Intronic
1044351946 8:91176741-91176763 GACTAGAACAAAAAGGTGGAGGG - Intronic
1045241717 8:100408471-100408493 TTATATGAGAAAAAGTTGAAAGG - Intronic
1045396557 8:101766434-101766456 ATATATAAGAAAAATCTGGAAGG - Intronic
1045893514 8:107186044-107186066 TATTATGAGAAAAAGGGGGAAGG + Intergenic
1047062033 8:121238032-121238054 TTGTATAAGATAAGGGTGAAAGG - Intergenic
1048169008 8:132087330-132087352 TAATATGAGAAAAAAGTGGAAGG + Intronic
1048199038 8:132356272-132356294 TTCTACAAGAAAAATGTGCTGGG + Intronic
1048934119 8:139341269-139341291 TTCTAGAAGTAAGAGCTGGAAGG + Intergenic
1049886956 9:34138-34160 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1050040147 9:1482277-1482299 TTCTAGAAGAAAAAGTAGGTAGG - Intergenic
1050176263 9:2872348-2872370 TTGTATAAGTCAAAGATGGATGG + Intergenic
1050565730 9:6880786-6880808 ATCTTTAAAAAAAAGGAGGAAGG - Intronic
1051180047 9:14401893-14401915 TCATATAAGCAAAAGGTGTAGGG - Intergenic
1051526043 9:18045748-18045770 TTCTTTAAGAAAAAGTTGTGTGG + Intergenic
1051846910 9:21462322-21462344 TTCTATTATAAAAAAGTAGAGGG + Intergenic
1051865850 9:21681517-21681539 TTCTATAAAAAACATTTGGAAGG + Intergenic
1052875607 9:33559988-33560010 ATCTATACGAAGAAGGTGGGTGG - Intronic
1053004605 9:34596151-34596173 TACTATAAGGAAAAAGAGGATGG - Intergenic
1053385096 9:37680799-37680821 TTCTATAATAAAAAGAGGGGAGG + Intronic
1053518785 9:38755438-38755460 TTCTATAGGAAAAAAATAGATGG + Intergenic
1056559763 9:87719790-87719812 TGCTCTAGGAACAAGGTGGAGGG + Intergenic
1056952627 9:91055772-91055794 TACAATATGAAAAAGGTGGAGGG - Intergenic
1057364006 9:94401543-94401565 GTCAACAAGAAAAAGGGGGAGGG - Intronic
1057406357 9:94774342-94774364 TTCTATAATAAATATGTGGAAGG - Intronic
1057659332 9:96986518-96986540 GTCAACAAGAAAAAGGGGGAGGG + Intronic
1059000217 9:110340902-110340924 TTCCACAAGAAAAAGGAGAATGG - Intergenic
1059094080 9:111393675-111393697 TTCTATCAGAAAATGATGGTAGG - Exonic
1059719991 9:116950644-116950666 TCCTACCAGAATAAGGTGGAAGG - Intronic
1059756164 9:117295682-117295704 ATCCATAATAAAATGGTGGAGGG + Intronic
1059811453 9:117859983-117860005 TTTTATAAGAAAGTTGTGGAGGG - Intergenic
1060547910 9:124471437-124471459 TTCTTCAAGGAAAAGATGGAGGG - Intronic
1061976713 9:134071969-134071991 TTCTCTTAGAAAAGGGTGGGAGG + Intergenic
1185514835 X:691756-691778 TTCTAAAAAAAAAAGGTCGGGGG - Intergenic
1187942606 X:24396550-24396572 TTTTTTAAGAAAAATTTGGAGGG - Intergenic
1188093077 X:25987688-25987710 TTCTATAAGATAAAAGTGAAAGG + Intergenic
1188274907 X:28188224-28188246 TTCTCTCAGAAAATGGTGCAGGG + Intergenic
1188513553 X:30961530-30961552 TTCTTTAACAAGAAGGTAGATGG + Intronic
1188535696 X:31194425-31194447 TCCTTTAAGAAAATGGTGTATGG + Intronic
1188833615 X:34931014-34931036 CTCCATAACAAAAAGGTGCAAGG + Intergenic
1189049240 X:37627053-37627075 TTCTATAGAAAAAATGAGGATGG + Intronic
1189171687 X:38915640-38915662 TTCTAAAAGAAAAATCTGCAAGG - Intergenic
1189422768 X:40871299-40871321 TTCTATAAAAAAAAGATACATGG - Intergenic
1189716705 X:43874486-43874508 TACTATAAAGATAAGGTGGATGG - Intronic
1189815273 X:44818409-44818431 TTCTATAAGAAAATAGGGGTCGG - Intergenic
1190101651 X:47526795-47526817 TTGTAAAATAAAAAGGTAGATGG + Intergenic
1190128601 X:47726343-47726365 TGCCCTAAGAAAAAGGTGCATGG - Intergenic
1190549998 X:51570282-51570304 ATCAATAAGAAAAAGGGGAAGGG - Intergenic
1192076001 X:67997489-67997511 TTCTAAAAAAAAAATGAGGAGGG - Intergenic
1192803739 X:74492397-74492419 TTATCTAAGTAAAAGGTAGAGGG + Intronic
1194700637 X:97109580-97109602 TTCTTTAAGAAAAAGCTGTATGG + Intronic
1194842797 X:98764783-98764805 TTATAAAAGAAAAATATGGATGG + Intergenic
1195447951 X:104975359-104975381 TGCTGTAGGAAAAAAGTGGAAGG - Intronic
1196990406 X:121322599-121322621 TTTGATAGGAAATAGGTGGAAGG - Intergenic
1197472826 X:126883695-126883717 TTGTACAAGAAAAAGGGGGCGGG - Intergenic
1198472684 X:136963528-136963550 TACTATAACAAAAAGTAGGAAGG + Intergenic
1199446896 X:147935179-147935201 TTCTATAACGAAAAGGGGAAAGG - Intronic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1200717029 Y:6558493-6558515 TTCTAAAAGCAAAAGGATGATGG + Intergenic