ID: 926583005 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:14652177-14652199 |
Sequence | CACTTGAATCCAGGAGACGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 154563 | |||
Summary | {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926583001_926583005 | 8 | Left | 926583001 | 2:14652146-14652168 | CCAGCTATTCGGGAGGCTGAGGC | 0: 3047 1: 106103 2: 269838 3: 285507 4: 311919 |
||
Right | 926583005 | 2:14652177-14652199 | CACTTGAATCCAGGAGACGGAGG | 0: 22 1: 910 2: 11219 3: 45370 4: 97042 |
||||
926582997_926583005 | 17 | Left | 926582997 | 2:14652137-14652159 | CCTGTACTCCCAGCTATTCGGGA | 0: 20 1: 3957 2: 114235 3: 306173 4: 559481 |
||
Right | 926583005 | 2:14652177-14652199 | CACTTGAATCCAGGAGACGGAGG | 0: 22 1: 910 2: 11219 3: 45370 4: 97042 |
||||
926582999_926583005 | 9 | Left | 926582999 | 2:14652145-14652167 | CCCAGCTATTCGGGAGGCTGAGG | 0: 3351 1: 113068 2: 299072 3: 329859 4: 341738 |
||
Right | 926583005 | 2:14652177-14652199 | CACTTGAATCCAGGAGACGGAGG | 0: 22 1: 910 2: 11219 3: 45370 4: 97042 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926583005 | Original CRISPR | CACTTGAATCCAGGAGACGG AGG | Intergenic | ||
Too many off-targets to display for this crispr |