ID: 926583005

View in Genome Browser
Species Human (GRCh38)
Location 2:14652177-14652199
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926583001_926583005 8 Left 926583001 2:14652146-14652168 CCAGCTATTCGGGAGGCTGAGGC 0: 3047
1: 106103
2: 269838
3: 285507
4: 311919
Right 926583005 2:14652177-14652199 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
926582997_926583005 17 Left 926582997 2:14652137-14652159 CCTGTACTCCCAGCTATTCGGGA 0: 20
1: 3957
2: 114235
3: 306173
4: 559481
Right 926583005 2:14652177-14652199 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
926582999_926583005 9 Left 926582999 2:14652145-14652167 CCCAGCTATTCGGGAGGCTGAGG 0: 3351
1: 113068
2: 299072
3: 329859
4: 341738
Right 926583005 2:14652177-14652199 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926583005 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intergenic
Too many off-targets to display for this crispr