ID: 926591630

View in Genome Browser
Species Human (GRCh38)
Location 2:14745868-14745890
Sequence AGATCTGACTCACTCTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926591630_926591634 -6 Left 926591630 2:14745868-14745890 CCATTCCAGAGTGAGTCAGATCT No data
Right 926591634 2:14745885-14745907 AGATCTTAGTTTCGGACAGGAGG No data
926591630_926591633 -9 Left 926591630 2:14745868-14745890 CCATTCCAGAGTGAGTCAGATCT No data
Right 926591633 2:14745882-14745904 GTCAGATCTTAGTTTCGGACAGG No data
926591630_926591635 4 Left 926591630 2:14745868-14745890 CCATTCCAGAGTGAGTCAGATCT No data
Right 926591635 2:14745895-14745917 TTCGGACAGGAGGCTAGTTCTGG No data
926591630_926591636 15 Left 926591630 2:14745868-14745890 CCATTCCAGAGTGAGTCAGATCT No data
Right 926591636 2:14745906-14745928 GGCTAGTTCTGGAACCAATGTGG No data
926591630_926591637 16 Left 926591630 2:14745868-14745890 CCATTCCAGAGTGAGTCAGATCT No data
Right 926591637 2:14745907-14745929 GCTAGTTCTGGAACCAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926591630 Original CRISPR AGATCTGACTCACTCTGGAA TGG (reversed) Intergenic
No off target data available for this crispr