ID: 926591631

View in Genome Browser
Species Human (GRCh38)
Location 2:14745873-14745895
Sequence AACTAAGATCTGACTCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926591631_926591639 27 Left 926591631 2:14745873-14745895 CCAGAGTGAGTCAGATCTTAGTT No data
Right 926591639 2:14745923-14745945 ATGTGGGTAGCAAGAATCCAAGG No data
926591631_926591637 11 Left 926591631 2:14745873-14745895 CCAGAGTGAGTCAGATCTTAGTT No data
Right 926591637 2:14745907-14745929 GCTAGTTCTGGAACCAATGTGGG No data
926591631_926591635 -1 Left 926591631 2:14745873-14745895 CCAGAGTGAGTCAGATCTTAGTT No data
Right 926591635 2:14745895-14745917 TTCGGACAGGAGGCTAGTTCTGG No data
926591631_926591636 10 Left 926591631 2:14745873-14745895 CCAGAGTGAGTCAGATCTTAGTT No data
Right 926591636 2:14745906-14745928 GGCTAGTTCTGGAACCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926591631 Original CRISPR AACTAAGATCTGACTCACTC TGG (reversed) Intergenic
No off target data available for this crispr