ID: 926591637

View in Genome Browser
Species Human (GRCh38)
Location 2:14745907-14745929
Sequence GCTAGTTCTGGAACCAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926591631_926591637 11 Left 926591631 2:14745873-14745895 CCAGAGTGAGTCAGATCTTAGTT No data
Right 926591637 2:14745907-14745929 GCTAGTTCTGGAACCAATGTGGG No data
926591630_926591637 16 Left 926591630 2:14745868-14745890 CCATTCCAGAGTGAGTCAGATCT No data
Right 926591637 2:14745907-14745929 GCTAGTTCTGGAACCAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926591637 Original CRISPR GCTAGTTCTGGAACCAATGT GGG Intergenic
No off target data available for this crispr