ID: 926592772

View in Genome Browser
Species Human (GRCh38)
Location 2:14757521-14757543
Sequence GACCGCCGTGACCACGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926592772_926592776 -9 Left 926592772 2:14757521-14757543 CCCTCACCGTGGTCACGGCGGTC No data
Right 926592776 2:14757535-14757557 ACGGCGGTCTTTGGCATCACTGG No data
926592772_926592777 23 Left 926592772 2:14757521-14757543 CCCTCACCGTGGTCACGGCGGTC No data
Right 926592777 2:14757567-14757589 TAACACCATGATGACTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926592772 Original CRISPR GACCGCCGTGACCACGGTGA GGG (reversed) Intergenic
No off target data available for this crispr